View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5_15_75 (Length: 331)

Name: J5_15_75
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5_15_75
J5_15_75
[»] chr4 (2 HSPs)
chr4 (46-328)||(54081503-54081785)
chr4 (157-309)||(54085019-54085174)


Alignment Details
Target: chr4 (Bit Score: 261; Significance: 1e-145; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 46 - 328
Target Start/End: Original strand, 54081503 - 54081785
Alignment:
46 ttaattcaggaaatgcatgaattgactaatatataactaactaatatggttgacacaaataaangaaaatataagtagcagctggtgtgaatgaaataat 145  Q
    |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
54081503 ttaattcaggaaatgcatgaattgactaatatataaataactaatatggttgacacaaataaaagaaaatataagtagcagctggtgtgaatgaaataat 54081602  T
146 gaacacgttagatggttgattccntgcatcatgtgtgttttagtgaagaaaaattngttgtgtttcaatttcaaccttttgttttagtcttcttgttatg 245  Q
    ||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
54081603 gaacacgttagatggttgattccatgcatcatgtgtgttttagtgaagaaaaattagttgtgtttcaatttcaaccttttgttttagtcttcttgttatg 54081702  T
246 aaaatttccaatatctacttgtaatttggcatagctttaactttttgagttgnagatgatggcactgntgtattgtaccntgg 328  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||| |||    
54081703 aaaatttccaatatctacttgtaatttggcatagctttaactttttgagttgtagatgatggcactgttgtattgtaccatgg 54081785  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 157 - 309
Target Start/End: Original strand, 54085019 - 54085174
Alignment:
157 atggttgattccntgcatcatgtgtgttttagtgaagaaaaattngttgtgtttcaatttcaaccttttgttttagtcttct--tgttatga----aaat 250  Q
    ||||||||| || |||||||||||||||||||| || ||||||  |||||||||||||| |||||||| ||||||||||| |  ||||||||    ||||    
54085019 atggttgatgccatgcatcatgtgtgttttagt-aataaaaatcagttgtgtttcaatt-caaccttt-gttttagtcttttcctgttatgattccaaat 54085115  T
251 ttccaatatctacttgtaatttggcatagctttaactttttgagttgnagatgatggca 309  Q
    ||||||||||||||||||||||||||||||||||  ||||||||| | |||||||||||    
54085116 ttccaatatctacttgtaatttggcatagctttagttttttgagtcgtagatgatggca 54085174  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 108421 times since January 2019
Visitors: 1329