View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5_15_79 (Length: 325)

Name: J5_15_79
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5_15_79
J5_15_79
[»] chr2 (4 HSPs)
chr2 (1-189)||(2102106-2102294)
chr2 (1-189)||(2095679-2095864)
chr2 (195-325)||(2102290-2102420)
chr2 (201-325)||(2095860-2095984)


Alignment Details
Target: chr2 (Bit Score: 189; Significance: 1e-102; HSPs: 4)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 189
Target Start/End: Complemental strand, 2102294 - 2102106
Alignment:
1 gttgggttcccaagtgaagtcaaattcagccctgcaagccttaatttaggtaatgttgcatttgaagtatagaagttttgttggaataacaactcattct 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2102294 gttgggttcccaagtgaagtcaaattcagccctgcaagccttaatttaggtaatgttgcatttgaagtatagaagttttgttggaataacaactcattct 2102195  T
101 ttgtactgctggaaccagaaataatatccttcattcatcatctgtttgcaggatcaagaactgttgccggaagtgctgcaggtggtaca 189  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2102194 ttgtactgctggaaccagaaataatatccttcattcatcatctgtttgcaggatcaagaactgttgccggaagtgctgcaggtggtaca 2102106  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 151; E-Value: 7e-80
Query Start/End: Original strand, 1 - 189
Target Start/End: Complemental strand, 2095864 - 2095679
Alignment:
1 gttgggttcccaagtgaagtcaaattcagccctgcaagccttaatttaggtaatgttgcatttgaagtatagaagttttgttggaataacaactcattct 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||    
2095864 gttgggttcccaagtgaagtcaaattcagccctgcaagccttaatttaggtaatgttgcatttgaagtatagaagttttgttgtaataacaactcgttct 2095765  T
101 ttgtactgctggaaccagaaataatatccttcattcatcatctgtttgcaggatcaagaactgttgccggaagtgctgcaggtggtaca 189  Q
    |||||| ||||||||||||||||||||||| |||   |||||||||||||||||||||||||||||||||||||| | |||||||||||    
2095764 ttgtaccgctggaaccagaaataatatcctccat---tcatctgtttgcaggatcaagaactgttgccggaagtgttacaggtggtaca 2095679  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 131; E-Value: 6e-68
Query Start/End: Original strand, 195 - 325
Target Start/End: Complemental strand, 2102420 - 2102290
Alignment:
195 aaattaatggtgacttctatgaaggcgttagctaaaacattggattttataattgacacggcttcgggtgatcacccatttgatccttacatgtcacttc 294  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2102420 aaattaatggtgacttctatgaaggcgttagctaaaacattggattttataattgacacggcttcgggtgatcacccatttgatccttacatgtcacttc 2102321  T
295 tgaagatatctggtgttctggccttagttgg 325  Q
    |||||||||||||||||||||||||||||||    
2102320 tgaagatatctggtgttctggccttagttgg 2102290  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 201 - 325
Target Start/End: Complemental strand, 2095984 - 2095860
Alignment:
201 atggtgacttctatgaaggcgttagctaaaacattggattttataattgacacggcttcgggtgatcacccatttgatccttacatgtcacttctgaaga 300  Q
    ||||||||||||||| ||||||| |||||| ||||||||||||||||||||||||| |||||||||||||  ||||||||||||||||||||||||||||    
2095984 atggtgacttctatgcaggcgttggctaaatcattggattttataattgacacggcatcgggtgatcacctgtttgatccttacatgtcacttctgaaga 2095885  T
301 tatctggtgttctggccttagttgg 325  Q
    ||||||||||||||| |||||||||    
2095884 tatctggtgttctggtcttagttgg 2095860  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 204656 times since January 2019
Visitors: 1518