View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5_15_86 (Length: 308)

Name: J5_15_86
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5_15_86
J5_15_86
[»] chr1 (3 HSPs)
chr1 (154-308)||(3425146-3425300)
chr1 (1-159)||(3425296-3425454)
chr1 (175-280)||(3428661-3428771)


Alignment Details
Target: chr1 (Bit Score: 155; Significance: 3e-82; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 155; E-Value: 3e-82
Query Start/End: Original strand, 154 - 308
Target Start/End: Original strand, 3425146 - 3425300
Alignment:
154 attaataaatacactattttctaataaaaaatcagttatgctttttaatacaagcaaaaaattcgagcacattcaagaagatgcattggctagtcgttag 253  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3425146 attaataaatacactattttctaataaaaaatcagttatgctttttaatacaagcaaaaaattcgagcacattcaagaagatgcattggctagtcgttag 3425245  T
254 agtgagaggaaaactcccaaaaatccagctcctataaccttaaacagttaaattc 308  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3425246 agtgagaggaaaactcccaaaaatccagctcctataaccttaaacagttaaattc 3425300  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 151; E-Value: 7e-80
Query Start/End: Original strand, 1 - 159
Target Start/End: Original strand, 3425296 - 3425454
Alignment:
1 aattctgcactcatttcttcagcaaatatctttaaaggcaaaagcaaaaccaacgcaaaatatagaaagaccaaaaagaagcagagagagtagtgaatga 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3425296 aattctgcactcatttcttcagcaaatatctttaaaggcaaaagcaaaaccaacgcaaaatatagaaagaccaaaaagaagcagagagagtagtgaatga 3425395  T
101 tggaagattaaaaataaataacaaattatcaaatcacaacattttcctattagattaat 159  Q
    |||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||    
3425396 tggaagattaaaaataaataacaaattatcaaatcacaacattttgatattagattaat 3425454  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 175 - 280
Target Start/End: Original strand, 3428661 - 3428771
Alignment:
175 taataaaaaatc-agttatgctttttaatacaagcaaaaaattcgagcacattc---aagaagatgc-attggctagtcgttagagtgagaggaaaactc 269  Q
    |||||||||||| ||||||||||||  | |||||| ||||||| ||||||||||   |||||||||| ||||||| ||| || || ||||||||||||||    
3428661 taataaaaaatctagttatgcttttcgagacaagcgaaaaattagagcacattcaagaagaagatgcaattggctggtccttggaatgagaggaaaactc 3428760  T
270 ccaaaaatcca 280  Q
    | |||| ||||    
3428761 ctaaaattcca 3428771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 314166 times since January 2019
Visitors: 446