View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5_15_95 (Length: 245)

Name: J5_15_95
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5_15_95
J5_15_95
[»] chr5 (2 HSPs)
chr5 (65-243)||(15977075-15977252)
chr5 (1-73)||(15977450-15977522)


Alignment Details
Target: chr5 (Bit Score: 131; Significance: 4e-68; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 65 - 243
Target Start/End: Original strand, 15977075 - 15977252
Alignment:
65 caattaattcctttcctcatatctctatttgatccccataaaaaatatgcttaaacgacatgatggaattgcttttggatatagngctggnatgaacaaa 164  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||    
15977075 caattaattcctttcctcatatctctatttgatccccataaaaaatatgcttaaacgacatgatggaattgcttttggatatagtgctggcatgaacaaa 15977174  T
165 atttngagaattgaacaattctgccacaaataagagntgnttgccaaanattcaattgggncgtgacgntttcaagttt 243  Q
    | |  ||||||||||||||||||||||||||||||| || ||| |||| ||||||||||  ||||||  ||||||||||    
15977175 aataggagaattgaacaattctgccacaaataagagctgtttg-caaacattcaattggcccgtgacagtttcaagttt 15977252  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 73
Target Start/End: Original strand, 15977450 - 15977522
Alignment:
1 tataataacaaagtactccacagagtagtattatcctagaaagaggaaagaaattcttaaancacaattaatt 73  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||    
15977450 tataataacaaagtactccacagagtagtattatcctagaaagaggaaagaaattcttaaattacaattaatt 15977522  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 110601 times since January 2019
Visitors: 1335