View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5_16_28 (Length: 344)

Name: J5_16_28
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5_16_28
J5_16_28
[»] chr6 (4 HSPs)
chr6 (65-344)||(26340072-26340351)
chr6 (1-70)||(26340007-26340076)
chr6 (120-249)||(28152559-28152688)
chr6 (121-287)||(28095073-28095239)


Alignment Details
Target: chr6 (Bit Score: 239; Significance: 1e-132; HSPs: 4)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 65 - 344
Target Start/End: Complemental strand, 26340351 - 26340072
Alignment:
65 caattgatttgcaacnccctggcagggtaggattgtatgaagcaattttcaagattgaatggaaccatgcggaggttacataagatttttcgatcatgcc 164  Q
    |||||||||||||||  | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26340351 caattgatttgcaactacatggcagggtaggattgtatgaagcaattttcaagattgaatggaaccatgcggaggttacataagatttttcgatcatgcc 26340252  T
165 atttcacttttaaggaaactcgaatgcncatattcaaacaggaatgtagcatagagaatattcnatcaccaatccttttaaaaagagtgattcanatgat 264  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||    
26340251 atttcacttttaaggaaactcgaatgcacatattcaaacaggaatgtagcatagagaatattcaatcaccaatccttttaaaaagagtgattcagatgat 26340152  T
265 gatgttcttgatgatgttgatgacaacnaccactcttcacnatggntacnaccaancncntattcaaacatgtgactttt 344  Q
    ||||||||||||||||||||||||||| |||||||||||| |||| ||| ||||| | | ||||||||||||||||||||    
26340151 gatgttcttgatgatgttgatgacaacgaccactcttcacaatggttacgaccaatcacatattcaaacatgtgactttt 26340072  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 1 - 70
Target Start/End: Complemental strand, 26340076 - 26340007
Alignment:
1 cttttgacaaaacttgtgtaccagaaacaatgaataaaatcattgtcatgcatgtgaaagtggtcaattg 70  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
26340076 cttttgacaaaacttgtgcaccagaaacaatgaataaaatcattgtcatgcatgtgaaagtggtcaattg 26340007  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 120 - 249
Target Start/End: Original strand, 28152559 - 28152688
Alignment:
120 tgaatggaaccatgcggaggttacataagatttttcgatcatgccatttcacttttaaggaaactcgaatgcncatattcaaacaggaatgtagcataga 219  Q
    ||||||||||||||||| |||||  || ||||||||||||||||||||| ||  ||||||||| ||||||||  ||||||||||| ||| | ||||| ||    
28152559 tgaatggaaccatgcggtggttaggtatgatttttcgatcatgccatttgac-cttaaggaaagtcgaatgcatatattcaaacaagaaagcagcatgga 28152657  T
220 gaatattc-natcaccaatccttttaaaaag 249  Q
    | ||||||   |||||||||||| |||||||    
28152658 ggatattcagttcaccaatccttataaaaag 28152688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 121 - 287
Target Start/End: Complemental strand, 28095239 - 28095073
Alignment:
121 gaatggaaccatgcggaggttacataagatttttcgatcatgccatttcacttttaaggaaactcgaatgcncatattcaaacaggaatgtagcatagag 220  Q
    |||||||||||||||| ||||||||  ||| |||| |   |||||||| ||  ||||||||| |||||||| |||||| ||||| ||| |||| || |||    
28095239 gaatggaaccatgcggtggttacatgtgatatttcaactgtgccatttgac-cttaaggaaagtcgaatgcacatatttaaacaagaaagtagaatggag 28095141  T
221 aatattc-natcaccaatccttttaaaaagagtgattcanatgatgatgttcttgatgatgttgatga 287  Q
     ||||||   ||||||||| || ||||||||| || | |  |||||||| |  |||||||| ||||||    
28095140 gatattcagttcaccaatcattataaaaagagagaattagttgatgatgatgatgatgatgatgatga 28095073  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 108212 times since January 2019
Visitors: 1329