View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5_16_58 (Length: 243)

Name: J5_16_58
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5_16_58
J5_16_58
[»] chr5 (10 HSPs)
chr5 (1-227)||(36044823-36045048)
chr5 (94-179)||(19741587-19741672)
chr5 (93-227)||(29754963-29755096)
chr5 (93-196)||(19237663-19237766)
chr5 (96-223)||(22292379-22292506)
chr5 (94-179)||(2157834-2157919)
chr5 (135-227)||(23622542-23622634)
chr5 (94-196)||(26683475-26683577)
chr5 (95-176)||(40299901-40299982)
chr5 (109-227)||(29955473-29955591)
[»] chr8 (14 HSPs)
chr8 (1-223)||(26931874-26932095)
chr8 (93-227)||(2246730-2246864)
chr8 (96-227)||(17837163-17837294)
chr8 (96-223)||(14505721-14505848)
chr8 (96-227)||(34723862-34723993)
chr8 (96-227)||(37590046-37590177)
chr8 (96-223)||(15990423-15990550)
chr8 (109-227)||(953683-953801)
chr8 (96-220)||(14657722-14657846)
chr8 (109-196)||(10601107-10601194)
chr8 (93-212)||(20526196-20526315)
chr8 (121-211)||(23558677-23558767)
chr8 (96-143)||(1186545-1186592)
chr8 (94-179)||(35285032-35285117)
[»] chr1 (20 HSPs)
chr1 (1-227)||(5185281-5185505)
chr1 (93-227)||(24065210-24065344)
chr1 (94-191)||(41117187-41117284)
chr1 (93-227)||(29115408-29115542)
chr1 (96-223)||(40490027-40490154)
chr1 (93-179)||(13288084-13288170)
chr1 (96-173)||(24427558-24427635)
chr1 (96-223)||(30033582-30033709)
chr1 (145-227)||(3603530-3603612)
chr1 (93-227)||(4614887-4615021)
chr1 (96-214)||(9361767-9361885)
chr1 (96-227)||(24083375-24083508)
chr1 (120-196)||(9928977-9929053)
chr1 (96-148)||(10771217-10771269)
chr1 (117-209)||(35151231-35151323)
chr1 (93-196)||(16678784-16678887)
chr1 (96-227)||(21701482-21701613)
chr1 (157-212)||(47726324-47726379)
chr1 (157-212)||(47747630-47747685)
chr1 (95-227)||(34696112-34696244)
[»] chr7 (15 HSPs)
chr7 (28-227)||(48770044-48770243)
chr7 (94-179)||(15633227-15633312)
chr7 (96-214)||(17238695-17238813)
chr7 (93-227)||(33611042-33611176)
chr7 (109-227)||(3896478-3896596)
chr7 (94-178)||(13015021-13015105)
chr7 (96-227)||(32480215-32480346)
chr7 (93-227)||(48100749-48100883)
chr7 (96-227)||(30502506-30502637)
chr7 (96-194)||(2175046-2175144)
chr7 (109-215)||(3205152-3205258)
chr7 (98-227)||(24226216-24226345)
chr7 (183-227)||(44435539-44435583)
chr7 (116-191)||(39970026-39970101)
chr7 (96-212)||(41601433-41601549)
[»] chr2 (12 HSPs)
chr2 (93-227)||(11553324-11553458)
chr2 (93-227)||(11818452-11818586)
chr2 (93-227)||(14231020-14231154)
chr2 (95-179)||(36641358-36641442)
chr2 (96-214)||(44886295-44886413)
chr2 (96-223)||(16206539-16206666)
chr2 (96-180)||(27267944-27268028)
chr2 (93-196)||(10973588-10973691)
chr2 (96-163)||(11502322-11502389)
chr2 (93-227)||(33650874-33651008)
chr2 (95-196)||(17826750-17826851)
chr2 (94-227)||(23379867-23379999)
[»] chr6 (9 HSPs)
chr6 (93-227)||(16416598-16416732)
chr6 (4-227)||(23508859-23509081)
chr6 (96-223)||(34355757-34355884)
chr6 (93-227)||(30140947-30141081)
chr6 (96-223)||(1493255-1493382)
chr6 (96-227)||(16890210-16890341)
chr6 (96-143)||(9959227-9959274)
chr6 (184-227)||(13768241-13768284)
chr6 (96-213)||(13825472-13825589)
[»] chr4 (17 HSPs)
chr4 (93-227)||(13686005-13686139)
chr4 (93-227)||(54027711-54027845)
chr4 (152-227)||(4462628-4462703)
chr4 (94-227)||(16582347-16582480)
chr4 (93-226)||(37061059-37061192)
chr4 (96-223)||(20527792-20527919)
chr4 (96-223)||(55227612-55227739)
chr4 (96-223)||(30859363-30859490)
chr4 (93-227)||(12355221-12355355)
chr4 (93-227)||(27087456-27087590)
chr4 (96-171)||(16431420-16431495)
chr4 (93-196)||(27066580-27066683)
chr4 (93-196)||(27066774-27066877)
chr4 (93-227)||(27066355-27066489)
chr4 (112-167)||(35765943-35765998)
chr4 (94-179)||(34301807-34301892)
chr4 (96-176)||(28860789-28860869)
[»] chr3 (17 HSPs)
chr3 (93-227)||(49499407-49499541)
chr3 (96-227)||(19602928-19603059)
chr3 (93-224)||(18357104-18357236)
chr3 (135-227)||(36144765-36144857)
chr3 (96-223)||(6006048-6006175)
chr3 (109-223)||(29372965-29373079)
chr3 (94-179)||(16739487-16739572)
chr3 (96-215)||(31660994-31661113)
chr3 (96-215)||(31935240-31935359)
chr3 (96-215)||(31973498-31973617)
chr3 (96-224)||(18342634-18342763)
chr3 (96-223)||(17790152-17790279)
chr3 (96-223)||(19098594-19098721)
chr3 (96-143)||(31228238-31228285)
chr3 (94-189)||(31809160-31809255)
chr3 (96-165)||(53437536-53437605)
chr3 (96-176)||(18765653-18765733)
[»] scaffold0643 (1 HSPs)
scaffold0643 (93-227)||(1045-1179)
[»] scaffold0789 (1 HSPs)
scaffold0789 (96-143)||(4309-4356)
[»] scaffold0040 (1 HSPs)
scaffold0040 (96-143)||(62581-62628)
[»] scaffold0011 (1 HSPs)
scaffold0011 (96-143)||(191097-191144)
[»] scaffold1964 (1 HSPs)
scaffold1964 (93-186)||(1109-1202)


Alignment Details
Target: chr5 (Bit Score: 198; Significance: 1e-108; HSPs: 10)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 36044823 - 36045048
Alignment:
1 tacttgtgatgccttccatactactcagagacgactactttgaatttaggtgcattatttcttcctgtcgtactctagttagttannnnnnnaccaactc 100  Q
    ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||       ||||||||    
36044823 tacttgtgatgccttccatactactca-agacgactactttgaatttaggtgcattatttcttcctgtcgtactctagttagttatttttttaccaactc 36044921  T
101 tagagtgaagtttgttaggcgacaagccaatgaggttgctcatattcttgtaggagaagccacattactagctagtcccaccatttattttcatatgccc 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36044922 tagagtgaagtttgttaggcgacaagccaatgaggttgctcatattcttgtaggagaagccacattactagctagtcccaccatttattttcatatgccc 36045021  T
201 gaatgtattgaatctcttattattaat 227  Q
    |||||||||||||||||||||||||||    
36045022 gaatgtattgaatctcttattattaat 36045048  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 94 - 179
Target Start/End: Complemental strand, 19741672 - 19741587
Alignment:
94 ccaactctagagtgaagtttgttaggcgacaagccaatgaggttgctcatattcttgtaggagaagccacattactagctagtccc 179  Q
    |||||||||| ||||| ||||||||||||||||| || | ||||||||||  ||||| | ||||||||||||||||||||||||||    
19741672 ccaactctagggtgaaatttgttaggcgacaagctaacggggttgctcatgctcttgcaagagaagccacattactagctagtccc 19741587  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 93 - 227
Target Start/End: Complemental strand, 29755096 - 29754963
Alignment:
93 accaactctagagtgaagtttgttaggcgacaagccaatgaggttgctcatattcttgtaggagaagccacattactagctagtcccaccatttattttc 192  Q
    ||||||||||| ||| ||||||||||||||||||| |||| ||| ||||| | ||||| |  |||||||||||| || ||||||||| | || |||||||    
29755096 accaactctagggtggagtttgttaggcgacaagctaatgtggtggctcacactcttgca-aagaagccacatttctcgctagtcccgctatctattttc 29754998  T
193 atatgcccgaatgtattgaatctcttattattaat 227  Q
    |||| ||| | ||||||||| || | |||||||||    
29754997 atatacccaattgtattgaaactttgattattaat 29754963  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 93 - 196
Target Start/End: Original strand, 19237663 - 19237766
Alignment:
93 accaactctagagtgaagtttgttaggcgacaagccaatgaggttgctcatattcttgtaggagaagccacattactagctagtcccaccatttattttc 192  Q
    ||||||||||| ||| ||||| ||||||||||||| ||||||||||||||| |||||| | |||| | |||  ||||||||| | ||||  |||||||||    
19237663 accaactctagggtggagtttattaggcgacaagcaaatgaggttgctcatgttcttgcaagagaggtcacgctactagctaattccactgtttattttc 19237762  T
193 atat 196  Q
    ||||    
19237763 atat 19237766  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 96 - 223
Target Start/End: Original strand, 22292379 - 22292506
Alignment:
96 aactctagagtgaagtttgttaggcgacaagccaatgaggttgctcatattcttgtaggagaagccacattactagctagtcccaccatttattttcata 195  Q
    |||||||| ||| |||||||||||||||||||||| | ||||||||||  ||||| | | || ||||| |   ||||||||||| || |||||||| |||    
22292379 aactctagggtggagtttgttaggcgacaagccaacgtggttgctcatgctcttgcaagggaggccacgtctttagctagtcccgccgtttattttaata 22292478  T
196 tgcccgaatgtattgaatctcttattat 223  Q
    | ||| | ||||||||| ||||||||||    
22292479 tacccaattgtattgaaactcttattat 22292506  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 94 - 179
Target Start/End: Complemental strand, 2157919 - 2157834
Alignment:
94 ccaactctagagtgaagtttgttaggcgacaagccaatgaggttgctcatattcttgtaggagaagccacattactagctagtccc 179  Q
    |||||||| | ||| |||||||||||||||||||||| ||| ||||| ||  ||||| | |||||||||| |||||||||||||||    
2157919 ccaactctcgggtggagtttgttaggcgacaagccaacgagattgcttatgctcttgcaagagaagccacgttactagctagtccc 2157834  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 135 - 227
Target Start/End: Original strand, 23622542 - 23622634
Alignment:
135 gttgctcatattcttgtaggagaagccacattactagctagtcccaccatttattttcatatgcccgaatgtattgaatctcttattattaat 227  Q
    ||||||||| | |||| |||||||||||| || |||||||||| |    |||||||| | || ||||| ||||||||||||||||||||||||    
23622542 gttgctcatgtgcttgcaggagaagccacgtttctagctagtctcgttgtttattttaacatacccgattgtattgaatctcttattattaat 23622634  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 94 - 196
Target Start/End: Original strand, 26683475 - 26683577
Alignment:
94 ccaactctagagtgaagtttgttaggcgacaagccaatgaggttgctcatattcttgtaggagaagccacattactagctagtcccaccatttattttca 193  Q
    |||||||| | ||| ||||||||  ||||||||  |||| ||| ||||||| ||||| ||| || |||||||| || ||||||||| | |||||||||||    
26683475 ccaactctcgggtggagtttgttccgcgacaagttaatgtggtggctcatactcttgcaggggaggccacatttcttgctagtcccgctatttattttca 26683574  T
194 tat 196  Q
    |||    
26683575 tat 26683577  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 95 - 176
Target Start/End: Original strand, 40299901 - 40299982
Alignment:
95 caactctagagtgaagtttgttaggcgacaagccaatgaggttgctcatattcttgtaggagaagccacattactagctagt 176  Q
    ||||||| | ||| ||||||||||||||||||| || | ||||||||||| ||| |||| ||| |||||||| || ||||||    
40299901 caactctcgggtggagtttgttaggcgacaagcaaacgtggttgctcatactctcgtagaagaggccacatttctcgctagt 40299982  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 109 - 227
Target Start/End: Complemental strand, 29955591 - 29955473
Alignment:
109 agtttgttaggcgacaagccaatgaggttgctcatattcttgtaggagaagccacattactagctagtcccaccatttattttcatatgcccgaatgtat 208  Q
    |||||| |||||||||| | |||  |||||||||| | |||||| |||||| ||| || ||| |||||| ||   |||||||| | || || || |||||    
29955591 agtttgctaggcgacaaacaaatatggttgctcatgtgcttgtaagagaagtcacgtttctaactagtctcattgtttattttaacatacctgattgtat 29955492  T
209 tgaatctcttattattaat 227  Q
    ||||||| |||||||||||    
29955491 tgaatcttttattattaat 29955473  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 122; Significance: 1e-62; HSPs: 14)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 26932095 - 26931874
Alignment:
1 tacttgtgatgccttccatactactcagagacgactactttgaatttaggtgcattatttcttcctgtcgtactctagttagttannnnnnnaccaactc 100  Q
    |||||||||||||||||||||||||  || |||||| || ||||||| ||||||||||||||||||||||||||||||||||||        ||||||||    
26932095 tacttgtgatgccttccatactactt-gatacgactgctctgaatttgggtgcattatttcttcctgtcgtactctagttagttctttctttaccaactc 26931997  T
101 tagagtgaagtttgttaggcgacaagccaatgaggttgctcatattcttgtaggagaagccacattactagctagtcccaccatttattttcatatgccc 200  Q
    ||| ||  |||||||||||| |||||||||||| |||| |||| |||||| |||||||||||||||||||||||||| | ||||||||||||||||  ||    
26931996 tagggtagagtttgttaggcaacaagccaatgaagttgttcatgttcttgcaggagaagccacattactagctagtctcgccatttattttcatatatcc 26931897  T
201 gaatgtattgaatctcttattat 223  Q
    |||||||||||||||||||||||    
26931896 gaatgtattgaatctcttattat 26931874  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 93 - 227
Target Start/End: Complemental strand, 2246864 - 2246730
Alignment:
93 accaactctagagtgaagtttgttaggcgacaagccaatgaggttgctcatattcttgtaggagaagccacattactagctagtcccaccatttattttc 192  Q
    ||||||||||| ||| |||||||||||| |||||| || |||||||||||| |||||| |||||||| ||  |||||||||||||      |||||||||    
2246864 accaactctagggtggagtttgttaggcaacaagcaaacgaggttgctcatgttcttgcaggagaagtcatgttactagctagtcatgttgtttattttc 2246765  T
193 atatgcccgaatgtattgaatctcttattattaat 227  Q
    | || || || ||||||||| ||||||||||||||    
2246764 acatacctgattgtattgaacctcttattattaat 2246730  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 96 - 227
Target Start/End: Complemental strand, 17837294 - 17837163
Alignment:
96 aactctagagtgaagtttgttaggcgacaagccaatgaggttgctcatattcttgtaggagaagccacattactagctagtcccaccatttattttcata 195  Q
    |||||||| ||| |||||||||||||||||||||| | ||||||||||| ||||| | |||||||||| |   ||||||||||  || |||||||  |||    
17837294 aactctagggtggagtttgttaggcgacaagccaacgcggttgctcatactcttgcaagagaagccacgtctttagctagtcctgccgtttatttcgata 17837195  T
196 tgcccgaatgtattgaatctcttattattaat 227  Q
    | ||||| | |||||||||| | |||||||||    
17837194 tacccgattatattgaatctttaattattaat 17837163  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 96 - 223
Target Start/End: Original strand, 14505721 - 14505848
Alignment:
96 aactctagagtgaagtttgttaggcgacaagccaatgaggttgctcatattcttgtaggagaagccacattactagctagtcccaccatttattttcata 195  Q
    |||||||| ||| |||||||||||||||||||||| | ||||||||||  ||||| | | || ||||| |   ||||||||||| || |||||||| |||    
14505721 aactctagggtggagtttgttaggcgacaagccaacgtggttgctcatgctcttgcaagggaggccacgtctttagctagtcccgccgtttattttaata 14505820  T
196 tgcccgaatgtattgaatctcttattat 223  Q
    | ||| | ||||||||| ||||||||||    
14505821 tacccaattgtattgaaactcttattat 14505848  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 96 - 227
Target Start/End: Complemental strand, 34723993 - 34723862
Alignment:
96 aactctagagtgaagtttgttaggcgacaagccaatgaggttgctcatattcttgtaggagaagccacattactagctagtcccaccatttattttcata 195  Q
    ||||| || ||| |||||||||||||||||||||| | ||||||||||| ||||| | |||||||||| |   ||||||||| | || |||||| | |||    
34723993 aactccagggtggagtttgttaggcgacaagccaacgtggttgctcatactcttgcaagagaagccacgtctttagctagtctcgccgtttattatgata 34723894  T
196 tgcccgaatgtattgaatctcttattattaat 227  Q
    | ||| | |||||||||||| |||| ||||||    
34723893 tacccaattgtattgaatctattatgattaat 34723862  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 96 - 227
Target Start/End: Complemental strand, 37590177 - 37590046
Alignment:
96 aactctagagtgaagtttgttaggcgacaagccaatgaggttgctcatattcttgtaggagaagccacattactagctagtcccaccatttattttcata 195  Q
    |||||||| ||| |||||||||||||||||||||| | ||||||||||  ||||| | | || ||||| |   |||||||| || || |||||||| |||    
37590177 aactctagggtggagtttgttaggcgacaagccaacgtggttgctcatgctcttgcaagggaggccacgtctttagctagttccgccgtttattttaata 37590078  T
196 tgcccgaatgtattgaatctcttattattaat 227  Q
    | ||| | ||||||||| ||||||||||||||    
37590077 tacccaattgtattgaaactcttattattaat 37590046  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 96 - 223
Target Start/End: Complemental strand, 15990550 - 15990423
Alignment:
96 aactctagagtgaagtttgttaggcgacaagccaatgaggttgctcatattcttgtaggagaagccacattactagctagtcccaccatttattttcata 195  Q
    |||||||| ||| |||||||||||||||||||| | | ||||||||||  ||||| | | || ||||| |   ||||||||||| || |||||||| |||    
15990550 aactctagggtggagtttgttaggcgacaagcctacgtggttgctcatgctcttgcaagggaggccacgtctttagctagtcccgccgtttattttaata 15990451  T
196 tgcccgaatgtattgaatctcttattat 223  Q
    | ||| | ||||||||| ||||||||||    
15990450 tacccaattgtattgaaactcttattat 15990423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 109 - 227
Target Start/End: Original strand, 953683 - 953801
Alignment:
109 agtttgttaggcgacaagccaatgaggttgctcatattcttgtaggagaagccacattactagctagtcccaccatttattttcatatgcccgaatgtat 208  Q
    ||||||||  ||||||||| || ||| |||||||| |||||| |||||||| ||| |||||||||||||||    |||||||||| ||  |  | |||||    
953683 agtttgtttagcgacaagcaaacgagtttgctcatgttcttgcaggagaagtcacgttactagctagtcccgttgtttattttcacatatctaattgtat 953782  T
209 tgaatctcttattattaat 227  Q
    |||| ||||||||||||||    
953783 tgaacctcttattattaat 953801  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 96 - 220
Target Start/End: Complemental strand, 14657846 - 14657722
Alignment:
96 aactctagagtgaagtttgttaggcgacaagccaatgaggttgctcatattcttgtaggagaagccacattactagctagtcccaccatttattttcata 195  Q
    |||||||| ||| ||||||||||||||||||||||  ||||  |||||  ||||| | |||||||||| |||||||| |||| ||   |||||||| |||    
14657846 aactctagggtggagtttgttaggcgacaagccaacaaggtatctcatgctcttgcaagagaagccacgttactagccagtcacattgtttattttgata 14657747  T
196 tgcccgaatgtattgaatctcttat 220  Q
    | ||  | ||||||||| |||||||    
14657746 tacctaattgtattgaaactcttat 14657722  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 109 - 196
Target Start/End: Original strand, 10601107 - 10601194
Alignment:
109 agtttgttaggcgacaagccaatgaggttgctcatattcttgtaggagaagccacattactagctagtcccaccatttattttcatat 196  Q
    |||||||| |||||||||| |||| ||| ||||| | ||| | ||| ||||||||||| || ||||||||||| |||||| |||||||    
10601107 agtttgttcggcgacaagctaatgtggtggctcacactctcgcaggggaagccacatttctcgctagtcccactatttatcttcatat 10601194  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 93 - 212
Target Start/End: Complemental strand, 20526315 - 20526196
Alignment:
93 accaactctagagtgaagtttgttaggcgacaagccaatgaggttgctcatattcttgtaggagaagccacattactagctagtcccaccatttattttc 192  Q
    ||||||||| | ||| |||||||| |||||||||  |||| ||| ||||||| ||| | ||| || |||||||| ||  |||||| ||| ||||||||||    
20526315 accaactctcgggtggagtttgttcggcgacaagttaatgtggtggctcatactctcgcaggggaggccacatttctcactagtcgcactatttattttc 20526216  T
193 atatgcccgaatgtattgaa 212  Q
    |||| ||| | |||||||||    
20526215 atatacccaattgtattgaa 20526196  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 121 - 211
Target Start/End: Original strand, 23558677 - 23558767
Alignment:
121 gacaagccaatgaggttgctcatattcttgtaggagaagccacattactagctagtcccaccatttattttcatatgcccgaatgtattga 211  Q
    ||||||| |||| ||||| ||||| ||||| ||||||    ||||| |||||||||||||| ||||||||||| || ||| ||||||||||    
23558677 gacaagcaaatgtggttgttcatactcttgcaggagagataacatttctagctagtcccactatttattttcacataccccaatgtattga 23558767  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 96 - 143
Target Start/End: Original strand, 1186545 - 1186592
Alignment:
96 aactctagagtgaagtttgttaggcgacaagccaatgaggttgctcat 143  Q
    |||||||| ||| |||||||||||||||||||||| | ||||||||||    
1186545 aactctagggtggagtttgttaggcgacaagccaacgtggttgctcat 1186592  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 94 - 179
Target Start/End: Original strand, 35285032 - 35285117
Alignment:
94 ccaactctagagtgaagtttgttaggcgacaagccaatgaggttgctcatattcttgtaggagaagccacattactagctagtccc 179  Q
    |||||||||| ||| ||||||||||||||||||| || | ||| ||||||| ||||| | |||| ||||| |   |||||||||||    
35285032 ccaactctagggtggagtttgttaggcgacaagctaacgcggtggctcatactcttgcacgagaggccacgtccttagctagtccc 35285117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 106; Significance: 4e-53; HSPs: 20)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 5185505 - 5185281
Alignment:
1 tacttgtgatgccttccatactactcagagacgactactttgaatttaggtgcattatttcttcctgtcgtactctagttagttannnnnnnaccaactc 100  Q
    |||||||||||||||||||||||||| |||||||||||| ||||||| | |||||||||| ||| |||||||||||||||| ||        ||||||||    
5185505 tacttgtgatgccttccatactactc-gagacgactactctgaatttggatgcattattttttcatgtcgtactctagttaatt-tttctttaccaactc 5185408  T
101 tagagtgaagtttgttaggcgacaagccaatgaggttgctcatattcttgtaggagaagccacattactagctagtcccaccatttattttcatatgccc 200  Q
    ||| ||| ||||||||| ||||||| |||||||||||| |||| |||||| | |||||| |||||||| |||||||||| ||||||||||| |||| |||    
5185407 tagggtggagtttgttaagcgacaaaccaatgaggttgttcatgttcttgcaagagaagtcacattaccagctagtcccgccatttatttttatataccc 5185308  T
201 gaatgtattgaatctcttattattaat 227  Q
    |||| |||||||| |||||||||||||    
5185307 gaatatattgaatatcttattattaat 5185281  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 93 - 227
Target Start/End: Original strand, 24065210 - 24065344
Alignment:
93 accaactctagagtgaagtttgttaggcgacaagccaatgaggttgctcatattcttgtaggagaagccacattactagctagtcccaccatttattttc 192  Q
    ||||||| ||| ||| ||||||||||||||||||| || |||||||||||| |||||| |||||||||||| |||||||||||||||    |||||||||    
24065210 accaactttagggtggagtttgttaggcgacaagcaaacgaggttgctcatgttcttgcaggagaagccacgttactagctagtcccgttgtttattttc 24065309  T
193 atatgcccgaatgtattgaatctcttattattaat 227  Q
    | || ||||| |||||||||  |||||||||||||    
24065310 acatacccgattgtattgaacttcttattattaat 24065344  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 94 - 191
Target Start/End: Original strand, 41117187 - 41117284
Alignment:
94 ccaactctagagtgaagtttgttaggcgacaagccaatgaggttgctcatattcttgtaggagaagccacattactagctagtcccaccatttatttt 191  Q
    |||||||| | ||| |||||||||||||||||||||||||||||||||||  ||||| | |||||||||| |||||||||||||||||| ||||||||    
41117187 ccaactctcgggtggagtttgttaggcgacaagccaatgaggttgctcatgctcttgcaagagaagccacgttactagctagtcccaccgtttatttt 41117284  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 93 - 227
Target Start/End: Original strand, 29115408 - 29115542
Alignment:
93 accaactctagagtgaagtttgttaggcgacaagccaatgaggttgctcatattcttgtaggagaagccacattactagctagtcccaccatttattttc 192  Q
    ||||||||||| ||| |||||||||| |||||||| || |||||||||||| ||| |||| |||| | ||| |||||||||||||      |||||||||    
29115408 accaactctagggtgtagtttgttagacgacaagcaaacgaggttgctcatgttcctgtaagagaggtcacgttactagctagtcatgttgtttattttc 29115507  T
193 atatgcccgaatgtattgaatctcttattattaat 227  Q
    |||| ||||| ||||| ||| ||||||||||||||    
29115508 atatacccgattgtatggaacctcttattattaat 29115542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 96 - 223
Target Start/End: Complemental strand, 40490154 - 40490027
Alignment:
96 aactctagagtgaagtttgttaggcgacaagccaatgaggttgctcatattcttgtaggagaagccacattactagctagtcccaccatttattttcata 195  Q
    |||||||| ||| ||||||||||||||||| |||||||||| ||||||  ||||| | |||||| | | ||||||| ||||||| |  |||||||| |||    
40490154 aactctagggtggagtttgttaggcgacaaaccaatgaggtcgctcatgctcttgcaagagaagtcgcgttactagttagtcccgctgtttattttgata 40490055  T
196 tgcccgaatgtattgaatctcttattat 223  Q
    | || |||| ||||||| ||||||||||    
40490054 taccggaatatattgaaactcttattat 40490027  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 93 - 179
Target Start/End: Original strand, 13288084 - 13288170
Alignment:
93 accaactctagagtgaagtttgttaggcgacaagccaatgaggttgctcatattcttgtaggagaagccacattactagctagtccc 179  Q
    ||||||||||| ||| |||||| |||||||||| | |||| |||||||||| | |||| ||||||||||| ||| ||||||||||||    
13288084 accaactctagggtggagtttgctaggcgacaaacaaatgcggttgctcatgtgcttgcaggagaagccatatttctagctagtccc 13288170  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 96 - 173
Target Start/End: Complemental strand, 24427635 - 24427558
Alignment:
96 aactctagagtgaagtttgttaggcgacaagccaatgaggttgctcatattcttgtaggagaagccacattactagct 173  Q
    |||||||| ||  ||||| |||||||||||||||||||||| ||||||| ||||| | ||||| ||||||| ||||||    
24427635 aactctagggtcgagtttattaggcgacaagccaatgaggtcgctcatactcttgcaagagaaaccacattcctagct 24427558  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 96 - 223
Target Start/End: Original strand, 30033582 - 30033709
Alignment:
96 aactctagagtgaagtttgttaggcgacaagccaatgaggttgctcatattcttgtaggagaagccacattactagctagtcccaccatttattttcata 195  Q
    |||||||| ||| |||||||||||||||||||||  | ||||||||||  ||||| | | || ||||| |   ||||||||||| || |||||||| |||    
30033582 aactctagggtggagtttgttaggcgacaagccagcgtggttgctcatgctcttgcaagggaggccacgtctttagctagtcccgccgtttattttaata 30033681  T
196 tgcccgaatgtattgaatctcttattat 223  Q
    | ||| | | ||||||| ||||||||||    
30033682 tacccaattatattgaaactcttattat 30033709  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 145 - 227
Target Start/End: Complemental strand, 3603612 - 3603530
Alignment:
145 ttcttgtaggagaagccacattactagctagtcccaccatttattttcatatgcccgaatgtattgaatctcttattattaat 227  Q
    |||||| |||||| ||||| |||||||||| ||||    ||||||||||||| | ||| ||||||||| ||||||||||||||    
3603612 ttcttgcaggagaggccacgttactagctactcccgttgtttattttcatatacacgattgtattgaacctcttattattaat 3603530  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 93 - 227
Target Start/End: Original strand, 4614887 - 4615021
Alignment:
93 accaactctagagtgaagtttgttaggcgacaagccaatgaggttgctcatattcttgtaggagaagccacattactagctagtcccaccatttattttc 192  Q
    ||||||||||| ||| |||||| |||||||||| | |||| |||||||||| | |||| || ||||||||| || ||| ||||| ||    || |||||     
4614887 accaactctagggtggagtttgctaggcgacaaacaaatgtggttgctcatgtgcttgcagaagaagccacgtttctaactagttccgttgttgatttta 4614986  T
193 atatgcccgaatgtattgaatctcttattattaat 227  Q
    | ||  |||| ||||||||||||| ||||||||||    
4614987 acataaccgattgtattgaatctcgtattattaat 4615021  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 96 - 214
Target Start/End: Original strand, 9361767 - 9361885
Alignment:
96 aactctagagtgaagtttgttaggcgacaagccaatgaggttgctcatattcttgtaggagaagccacattactagctagtcccaccatttattttcata 195  Q
    |||||||| ||| |||||||||||||||||||||| | ||||||||||   |||| | |||||||||| ||  || |||||| | | ||||||| | |||    
9361767 aactctagggtggagtttgttaggcgacaagccaacgcggttgctcatgcacttgcaagagaagccacgttcttaactagtctcgctatttattatgata 9361866  T
196 tgcccgaatgtattgaatc 214  Q
    | || ||||||| ||||||    
9361867 tacctgaatgtactgaatc 9361885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 96 - 227
Target Start/End: Original strand, 24083375 - 24083508
Alignment:
96 aactctagagtgaagtttgttaggcgacaagccaatgaggttgctcatattcttgtaggagaagccacattactagctagtcccaccatttat--tttca 193  Q
    |||||||  ||| |||||||||||||||||||||| | ||||||||||   |||| | |||||||||| ||  ||||||||||| | ||||||  | | |    
24083375 aactctacggtggagtttgttaggcgacaagccaacgcggttgctcatgcacttgcaagagaagccacgttcttagctagtcccgctatttattatatga 24083474  T
194 tatgcccgaatgtattgaatctcttattattaat 227  Q
    ||| || ||||||||||||||  | |||||||||    
24083475 tataccagaatgtattgaatccttaattattaat 24083508  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 120 - 196
Target Start/End: Original strand, 9928977 - 9929053
Alignment:
120 cgacaagccaatgaggttgctcatattcttgtaggagaagccacattactagctagtcccaccatttattttcatat 196  Q
    |||||| | |||||||| ||||||  ||| | ||||||| |||||||| ||||||||||||| || |||||||||||    
9928977 cgacaaacaaatgaggtggctcatgctctagcaggagaaaccacattattagctagtcccactatatattttcatat 9929053  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 96 - 148
Target Start/End: Original strand, 10771217 - 10771269
Alignment:
96 aactctagagtgaagtttgttaggcgacaagccaatgaggttgctcatattct 148  Q
    |||||| | ||| |||||||||||||||||||||||| ||| |||||||||||    
10771217 aactctcgggtggagtttgttaggcgacaagccaatgtggtagctcatattct 10771269  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 117 - 209
Target Start/End: Original strand, 35151231 - 35151323
Alignment:
117 aggcgacaagccaatgaggttgctcatattcttgtaggagaagccacattactagctagtcccaccatttattttcatatgcccgaatgtatt 209  Q
    ||||||||||| |||| ||| | ||||  ||| | |||||||||| |||||  |||||||||||| |||||||||||||| || || ||||||    
35151231 aggcgacaagcaaatgtggtggttcatgctctagcaggagaagccgcattatcagctagtcccactatttattttcatatccctgattgtatt 35151323  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 93 - 196
Target Start/End: Complemental strand, 16678887 - 16678784
Alignment:
93 accaactctagagtgaagtttgttaggcgacaagccaatgaggttgctcatattcttgtaggagaagccacattactagctagtcccaccatttattttc 192  Q
    ||||||||| | ||| |||||||| ||||||||   |||| ||| ||||| | ||| | ||| ||||||||||| || ||| ||||||| ||||||||||    
16678887 accaactctcgcgtggagtttgttcggcgacaaattaatgtggtggctcacactctcgcaggggaagccacatttctcgcttgtcccactatttattttc 16678788  T
193 atat 196  Q
    ||||    
16678787 atat 16678784  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 96 - 227
Target Start/End: Complemental strand, 21701613 - 21701482
Alignment:
96 aactctagagtgaagtttgttaggcgacaagccaatgaggttgctcatattcttgtaggagaagccacattactagctagtcccaccatttattttcata 195  Q
    |||||||| ||| |||||||||||||| ||||||| | ||||||||||  ||||  | |||| ||||| |   ||||||||||| || |||||| | |||    
21701613 aactctagggtggagtttgttaggcgataagccaacgtggttgctcatgctctttcacgagaggccacgtctttagctagtcccgccgtttattatgata 21701514  T
196 tgcccgaatgtattgaatctcttattattaat 227  Q
    | | | | ||||||||| ||||||| ||||||    
21701513 tactcaattgtattgaaactcttatgattaat 21701482  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 47726324 - 47726379
Alignment:
157 aagccacattactagctagtcccaccatttattttcatatgcccgaatgtattgaa 212  Q
    |||||||||| || ||||||||||| |||||||||||||| ||| | |||||||||    
47726324 aagccacatttctcgctagtcccactatttattttcatatacccaattgtattgaa 47726379  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #19
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 47747630 - 47747685
Alignment:
157 aagccacattactagctagtcccaccatttattttcatatgcccgaatgtattgaa 212  Q
    |||||||||| || ||||||||||| |||||||||||||| ||| | |||||||||    
47747630 aagccacatttctcgctagtcccactatttattttcatatacccaattgtattgaa 47747685  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #20
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 95 - 227
Target Start/End: Complemental strand, 34696244 - 34696112
Alignment:
95 caactctagagtgaagtttgttaggcgacaagccaatgaggttgctcatattcttgtaggagaagccacattactagctagtcccaccatttattttcat 194  Q
    ||||||| | ||| |||||| |||| ||||||  |||| ||||||||||| ||| | ||||||  |||| || |||||||||| |    |||||||||||    
34696244 caactctcgggtggagtttgctaggagacaagaaaatgtggttgctcatactctcgaaggagagaccacgtttctagctagtctcgttgtttattttcat 34696145  T
195 atgcccgaatgtattgaatctcttattattaat 227  Q
    || ||| | ||||||||| || | |||||||||    
34696144 ataccccattgtattgaaactttgattattaat 34696112  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 91; Significance: 3e-44; HSPs: 15)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 28 - 227
Target Start/End: Original strand, 48770044 - 48770243
Alignment:
28 gagacgactactttgaatttaggtgcattatttcttcctgtcgtactctagttagttannnnnnnaccaactctagagtgaagtttgttaggcgacaagc 127  Q
    |||||||||| | ||| ||| | || ||||||||||| ||||| ||||||||||| |        ||||||||||| ||| ||||| || ||||| ||||    
48770044 gagacgactattctgagtttggatgtattatttcttcatgtcgcactctagttagctctttttttaccaactctagggtggagtttattcggcgagaagc 48770143  T
128 caatgaggttgctcatattcttgtaggagaagccacattactagctagtcccaccatttattttcatatgcccgaatgtattgaatctcttattattaat 227  Q
     ||||||||||||||| |||| | ||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||    
48770144 taatgaggttgctcatgttctcgcaggagaagccacattacaagctagtcccaccatttattttcatatacccgaatgtattgaaactcttattattaat 48770243  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 94 - 179
Target Start/End: Original strand, 15633227 - 15633312
Alignment:
94 ccaactctagagtgaagtttgttaggcgacaagccaatgaggttgctcatattcttgtaggagaagccacattactagctagtccc 179  Q
    |||||||| | ||| |||||||||||||||||||||||||||||||||||| ||||| | |||||||||| |||||||||||||||    
15633227 ccaactctcgggtggagtttgttaggcgacaagccaatgaggttgctcatactcttgcaagagaagccacgttactagctagtccc 15633312  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 96 - 214
Target Start/End: Complemental strand, 17238813 - 17238695
Alignment:
96 aactctagagtgaagtttgttaggcgacaagccaatgaggttgctcatattcttgtaggagaagccacattactagctagtcccaccatttattttcata 195  Q
    |||||||| ||| |||||||||||||||||||||| | ||||||||||   |||| | |||||||||||||  || |||||||||| ||||||| | |||    
17238813 aactctagggtggagtttgttaggcgacaagccaacgcggttgctcatgcacttgcaagagaagccacattcttaactagtcccactatttattatgata 17238714  T
196 tgcccgaatgtattgaatc 214  Q
    | |||||||||||||||||    
17238713 tacccgaatgtattgaatc 17238695  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 93 - 227
Target Start/End: Complemental strand, 33611176 - 33611042
Alignment:
93 accaactctagagtgaagtttgttaggcgacaagccaatgaggttgctcatattcttgtaggagaagccacattactagctagtcccaccatttattttc 192  Q
    ||||||||||| ||| ||||||||||||||||||| ||   ||||| |||| |||||| |||||| ||||  ||||||||| |||||    |||||||||    
33611176 accaactctagggtggagtttgttaggcgacaagcaaacagggttgttcatgttcttgcaggagatgccatgttactagctggtcccgttgtttattttc 33611077  T
193 atatgcccgaatgtattgaatctcttattattaat 227  Q
    |||| ||||| ||||||||| ||||||||||||||    
33611076 atatacccgattgtattgaacctcttattattaat 33611042  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 109 - 227
Target Start/End: Original strand, 3896478 - 3896596
Alignment:
109 agtttgttaggcgacaagccaatgaggttgctcatattcttgtaggagaagccacattactagctagtcccaccatttattttcatatgcccgaatgtat 208  Q
    |||||||||||||||||||||| | ||||||||||   |||| | |||| ||||| |   ||||||||||| || |||||||| |||| ||||| |||||    
3896478 agtttgttaggcgacaagccaacgtggttgctcatgcacttgcaagagaggccacgtctttagctagtcccgccgtttattttgatatacccgattgtat 3896577  T
209 tgaatctcttattattaat 227  Q
    |||| ||||||||||||||    
3896578 tgaaactcttattattaat 3896596  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 94 - 178
Target Start/End: Complemental strand, 13015105 - 13015021
Alignment:
94 ccaactctagagtgaagtttgttaggcgacaagccaatgaggttgctcatattcttgtaggagaagccacattactagctagtcc 178  Q
    |||||||| | ||| |||||||||||||||||||||| ||||||||||||  ||||| | ||||| |||| ||||||||||||||    
13015105 ccaactctcgggtgtagtttgttaggcgacaagccaacgaggttgctcatgctcttgcaagagaatccacgttactagctagtcc 13015021  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 96 - 227
Target Start/End: Original strand, 32480215 - 32480346
Alignment:
96 aactctagagtgaagtttgttaggcgacaagccaatgaggttgctcatattcttgtaggagaagccacattactagctagtcccaccatttattttcata 195  Q
    |||||||| ||| |||||||||||||||||||||| | ||||||||||| ||||| | | || ||||| |   ||||||||||| |  |||||||| |||    
32480215 aactctagggtggagtttgttaggcgacaagccaacgtggttgctcatactcttgcaagggaggccacgtctttagctagtcccgcagtttattttaata 32480314  T
196 tgcccgaatgtattgaatctcttattattaat 227  Q
    | | | | ||||||||| ||||||||||||||    
32480315 tactcaattgtattgaaactcttattattaat 32480346  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 93 - 227
Target Start/End: Complemental strand, 48100883 - 48100749
Alignment:
93 accaactctagagtgaagtttgttaggcgacaagccaatgaggttgctcatattcttgtaggagaagccacattactagctagtcccaccatttattttc 192  Q
    ||||||||||| ||| |||||| |||||||||||| |||| |||||||||| | |||| ||||||| |||| || |||| |||||||    ||||||||     
48100883 accaactctagggtggagtttgctaggcgacaagcaaatgtggttgctcatgtgcttgcaggagaatccacgtttctagttagtcccgttgtttatttta 48100784  T
193 atatgcccgaatgtattgaatctcttattattaat 227  Q
     |||  | || |||||||||| |||||||||||||    
48100783 gtatatctgattgtattgaatatcttattattaat 48100749  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 96 - 227
Target Start/End: Original strand, 30502506 - 30502637
Alignment:
96 aactctagagtgaagtttgttaggcgacaagccaatgaggttgctcatattcttgtaggagaagccacattactagctagtcccaccatttattttcata 195  Q
    |||||||  ||| |||||||||  ||||||| ||| | ||||||||||| ||||| | |||| ||||| |   ||||||||||| |  |||||||| |||    
30502506 aactctaaggtggagtttgttactcgacaagtcaacgcggttgctcatactcttgcaagagaggccacgtccttagctagtcccgcagtttattttgata 30502605  T
196 tgcccgaatgtattgaatctcttattattaat 227  Q
    | ||||| ||||||||| ||||||||||||||    
30502606 tacccgattgtattgaaactcttattattaat 30502637  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 96 - 194
Target Start/End: Complemental strand, 2175144 - 2175046
Alignment:
96 aactctagagtgaagtttgttaggcgacaagccaatgaggttgctcatattcttgtaggagaagccacattactagctagtcccaccatttattttcat 194  Q
    |||||||| ||| ||||| ||  | |||||||  |||||||||||||| || | |||||||| ||||||||| ||| ||||||||||||||||| ||||    
2175144 aactctagggtggagtttattcagagacaagcagatgaggttgctcatgttttcgtaggagaggccacattagtagttagtcccaccatttattatcat 2175046  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 109 - 215
Target Start/End: Complemental strand, 3205258 - 3205152
Alignment:
109 agtttgttaggcgacaagccaatgaggttgctcatattcttgtaggagaagccacattactagctagtcccaccatttattttcatatgcccgaatgtat 208  Q
    ||||||||||||||||| |||| | ||||||||||  ||||| | |||||||||| |   ||||||||||| || |||||||  |||| ||||| |||||    
3205258 agtttgttaggcgacaacccaacgtggttgctcatgctcttgcaagagaagccacgtctttagctagtcccgccgtttatttcgatatacccgattgtat 3205159  T
209 tgaatct 215  Q
    | |||||    
3205158 taaatct 3205152  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 98 - 227
Target Start/End: Complemental strand, 24226345 - 24226216
Alignment:
98 ctctagagtgaagtttgttaggcgacaagccaatgaggttgctcatattcttgtaggagaagccacattactagctagtcccaccatttattttcatatg 197  Q
    |||||| ||| |||||||||||||||||||||| | ||||||||||  ||||| | |||| ||||| |   |||||||||||  | |||||| | ||||     
24226345 ctctagggtggagtttgttaggcgacaagccaacgcggttgctcatgctcttgcacgagaggccacgtctttagctagtcccgacgtttattatgatata 24226246  T
198 cccgaatgtattgaatctcttattattaat 227  Q
    |||   |||||| || ||||||||||||||    
24226245 cccacttgtatttaaactcttattattaat 24226216  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 183 - 227
Target Start/End: Original strand, 44435539 - 44435583
Alignment:
183 atttattttcatatgcccgaatgtattgaatctcttattattaat 227  Q
    ||||||||| ||||  |||||||||||||||||||||||||||||    
44435539 atttattttaatatatccgaatgtattgaatctcttattattaat 44435583  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 116 - 191
Target Start/End: Original strand, 39970026 - 39970101
Alignment:
116 taggcgacaagccaatgaggttgctcatattcttgtaggagaagccacattactagctagtcccaccatttatttt 191  Q
    |||||||||||| |||||||||||||| |  |||| || | ||||||||||| || |||| ||||| |||||||||    
39970026 taggcgacaagcaaatgaggttgctcacacacttgcagaataagccacattattaactagacccactatttatttt 39970101  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 96 - 212
Target Start/End: Original strand, 41601433 - 41601549
Alignment:
96 aactctagagtgaagtttgttaggcgacaagccaatgaggttgctcatattcttgtaggagaagccacattactagctagtcccaccatttattttcata 195  Q
    |||||||| ||| ||||||||||||| |||||||| | ||||| ||||  ||||| | |||| |||||||   ||||||||||| |  |||||| | |||    
41601433 aactctagggtggagtttgttaggcggcaagccaaagcggttgttcatgctcttgcacgagaggccacatctttagctagtcccgctgtttattatgata 41601532  T
196 tgcccgaatgtattgaa 212  Q
    | ||| | |||||||||    
41601533 tacccaattgtattgaa 41601549  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 83; Significance: 2e-39; HSPs: 12)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 93 - 227
Target Start/End: Original strand, 11553324 - 11553458
Alignment:
93 accaactctagagtgaagtttgttaggcgacaagccaatgaggttgctcatattcttgtaggagaagccacattactagctagtcccaccatttattttc 192  Q
    ||||||||||| ||| |||||  | |||||||||| |||||||||| |||| |||| | |||||||||||||||||||||||||||||||||||||||||    
11553324 accaactctagggtggagtttactcggcgacaagctaatgaggttgatcatgttctcgcaggagaagccacattactagctagtcccaccatttattttc 11553423  T
193 atatgcccgaatgtattgaatctcttattattaat 227  Q
    |||| ||||||| ||||||| ||||||||||||||    
11553424 atatacccgaatatattgaaactcttattattaat 11553458  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 93 - 227
Target Start/End: Complemental strand, 11818586 - 11818452
Alignment:
93 accaactctagagtgaagtttgttaggcgacaagccaatgaggttgctcatattcttgtaggagaagccacattactagctagtcccaccatttattttc 192  Q
    ||||||||||| ||| ||||||||||||||||||| || |||||||||||| |||||| |||||||||||| |||||||||||||||   ||||||||||    
11818586 accaactctagggtggagtttgttaggcgacaagcaaacgaggttgctcatgttcttgcaggagaagccacgttactagctagtcccgttatttattttc 11818487  T
193 atatgcccgaatgtattgaatctcttattattaat 227  Q
    | || ||| | | ||||||| ||||||||||||||    
11818486 agatacccaattatattgaacctcttattattaat 11818452  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 93 - 227
Target Start/End: Original strand, 14231020 - 14231154
Alignment:
93 accaactctagagtgaagtttgttaggcgacaagccaatgaggttgctcatattcttgtaggagaagccacattactagctagtcccaccatttattttc 192  Q
    ||||||||||||||| ||||||||||||||||||| |||| ||| ||||| | ||||| | | ||||||||||| || |||||||||   || |||||||    
14231020 accaactctagagtggagtttgttaggcgacaagctaatgtggtggctcacactcttgcaagggaagccacatttctcgctagtcccgttatctattttc 14231119  T
193 atatgcccgaatgtattgaatctcttattattaat 227  Q
    |||| ||| | ||||||||| || | |||||||||    
14231120 atatacccaattgtattgaaactttgattattaat 14231154  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 95 - 179
Target Start/End: Original strand, 36641358 - 36641442
Alignment:
95 caactctagagtgaagtttgttaggcgacaagccaatgaggttgctcatattcttgtaggagaagccacattactagctagtccc 179  Q
    ||||||| | ||| |||||||||||||||||||||| ||||||||||||  ||||| |  |||||||||||||||||||||||||    
36641358 caactctcgggtggagtttgttaggcgacaagccaacgaggttgctcatgctcttgcaaaagaagccacattactagctagtccc 36641442  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 96 - 214
Target Start/End: Original strand, 44886295 - 44886413
Alignment:
96 aactctagagtgaagtttgttaggcgacaagccaatgaggttgctcatattcttgtaggagaagccacattactagctagtcccaccatttattttcata 195  Q
    |||||||| ||| |||||||||||||||||| ||| | ||||||||||   |||| | |||||||||| ||  |||||| |||||| ||||||| | |||    
44886295 aactctagggtggagtttgttaggcgacaagtcaacgcggttgctcatgcacttgcaagagaagccacgttcttagctaatcccactatttattatgata 44886394  T
196 tgcccgaatgtattgaatc 214  Q
    | |||||||||||||||||    
44886395 tacccgaatgtattgaatc 44886413  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 96 - 223
Target Start/End: Original strand, 16206539 - 16206666
Alignment:
96 aactctagagtgaagtttgttaggcgacaagccaatgaggttgctcatattcttgtaggagaagccacattactagctagtcccaccatttattttcata 195  Q
    |||||||| ||| |||||||||||||||||||||| | ||||||||||  ||||| | | || ||||| |   ||||||||||| || |||||||| |||    
16206539 aactctagggtggagtttgttaggcgacaagccaacgtggttgctcatgctcttgcaagggaggccacgtctttagctagtcccgccgtttattttaata 16206638  T
196 tgcccgaatgtattgaatctcttattat 223  Q
    | ||| | ||||||||| ||||||||||    
16206639 tacccaattgtattgaaactcttattat 16206666  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 96 - 180
Target Start/End: Complemental strand, 27268028 - 27267944
Alignment:
96 aactctagagtgaagtttgttaggcgacaagccaatgaggttgctcatattcttgtaggagaagccacattactagctagtccca 180  Q
    |||||||| ||| ||||||||||| ||||||| || |||||||||||||  |||| | |||||||||| ||||||| ||||||||    
27268028 aactctagggtggagtttgttaggtgacaagctaacgaggttgctcatacacttgcaagagaagccacgttactagttagtccca 27267944  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 93 - 196
Target Start/End: Complemental strand, 10973691 - 10973588
Alignment:
93 accaactctagagtgaagtttgttaggcgacaagccaatgaggttgctcatattcttgtaggagaagccacattactagctagtcccaccatttattttc 192  Q
    ||||||||| | ||| |||||||| |||||||||| |||| ||| ||||| | ||| ||||| ||||||||||| || | | ||||||| ||||||||||    
10973691 accaactctcgggtggagtttgttcggcgacaagctaatgtggtggctcacactctcgtaggggaagccacatttctcgtttgtcccacaatttattttc 10973592  T
193 atat 196  Q
    ||||    
10973591 atat 10973588  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 96 - 163
Target Start/End: Original strand, 11502322 - 11502389
Alignment:
96 aactctagagtgaagtttgttaggcgacaagccaatgaggttgctcatattcttgtaggagaagccac 163  Q
    |||||||| ||| |||||||||||||||||||||| | ||||||||||| ||||| | ||||||||||    
11502322 aactctagggtggagtttgttaggcgacaagccaacgtggttgctcatactcttgcaagagaagccac 11502389  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 93 - 227
Target Start/End: Original strand, 33650874 - 33651008
Alignment:
93 accaactctagagtgaagtttgttaggcgacaagccaatgaggttgctcatattcttgtaggagaagccacattactagctagtcccaccatttattttc 192  Q
    ||||||||||||||||||||||  |||| |||||| |||| ||||| |||| | |||| || ||||| ||| || ||||||||||||    ||||||||     
33650874 accaactctagagtgaagtttgccaggcaacaagcaaatgcggttgttcatgtgcttgcagaagaagtcacgtttctagctagtcccgttgtttatttta 33650973  T
193 atatgcccgaatgtattgaatctcttattattaat 227  Q
    | || ||| |  ||||||||| |||||||||||||    
33650974 acatacccaatcgtattgaatatcttattattaat 33651008  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 95 - 196
Target Start/End: Original strand, 17826750 - 17826851
Alignment:
95 caactctagagtgaagtttgttaggcgacaagccaatgaggttgctcatattcttgtaggagaagccacattactagctagtcccaccatttattttcat 194  Q
    ||||||||  ||| |||||| |||||||||||  |||| ||| ||||| | | ||||||||||||||| ||| || ||||||||| | ||||||| ||||    
17826750 caactctacggtggagtttgctaggcgacaagataatgtggtggctcacactgttgtaggagaagccatattcctcgctagtcccgctatttattatcat 17826849  T
195 at 196  Q
    ||    
17826850 at 17826851  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 94 - 227
Target Start/End: Original strand, 23379867 - 23379999
Alignment:
94 ccaactctagagtgaagtttgttaggcgacaagccaatgaggttgctcatattcttgtaggagaagccacattactagctagtcccaccatttattttca 193  Q
    |||||||||| ||| ||||| ||||| |||| ||||| ||||||| | ||  ||| | | |||||| |||||||||||||||| || |  |||||||| |    
23379867 ccaactctagggtggagtttattaggtgaca-gccaacgaggttgtttatgctctcgcaagagaagtcacattactagctagttccgctgtttattttaa 23379965  T
194 tatgcccgaatgtattgaatctcttattattaat 227  Q
     || ||| | ||||||||| || |||||||||||    
23379966 aatacccaattgtattgaaactattattattaat 23379999  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 75; Significance: 1e-34; HSPs: 9)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 93 - 227
Target Start/End: Original strand, 16416598 - 16416732
Alignment:
93 accaactctagagtgaagtttgttaggcgacaagccaatgaggttgctcatattcttgtaggagaagccacattactagctagtcccaccatttattttc 192  Q
    ||||||||||| ||| ||||||||||||||||||  ||||||||||||| |||||||| |||||| | ||||||||||||||||| ||  ||||||||||    
16416598 accaactctagggtgtagtttgttaggcgacaagtaaatgaggttgctcgtattcttgcaggagatgtcacattactagctagtctcattatttattttc 16416697  T
193 atatgcccgaatgtattgaatctcttattattaat 227  Q
    |||| ||| | ||||||||| ||||||||||||||    
16416698 atatacccaattgtattgaacctcttattattaat 16416732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 4 - 227
Target Start/End: Complemental strand, 23509081 - 23508859
Alignment:
4 ttgtgatgccttccatactactcagagacgactactt-tgaatttaggtgcattatttcttcctgtcgtactctagttagttannnnnnnaccaactcta 102  Q
    |||||||||||||||| ||| || |||| ||| |||| |||||||||||||||||| || || |||||  ||||| ||||||        ||||| ||||    
23509081 ttgtgatgccttccatgctaatc-gagatgac-acttctgaatttaggtgcattatctcatcatgtcggtctctatttagttctttctttaccaattcta 23508984  T
103 gagtgaagtttgttaggcgacaagccaatgaggttgctcatattcttgtaggagaagccacattactagctagtcccaccatttattttcatatgcccga 202  Q
    | ||| ||||||||||||||||||| |||| |||||||||| |||||| ||||||||||||||||| ||||||||||    |||| ||||| || || ||    
23508983 gggtggagtttgttaggcgacaagcaaatggggttgctcatgttcttgcaggagaagccacattacgagctagtcccgttgtttaatttcacatacctga 23508884  T
203 atgtattgaatctcttattattaat 227  Q
     ||||||||| ||||||||||||||    
23508883 ttgtattgaacctcttattattaat 23508859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 96 - 223
Target Start/End: Complemental strand, 34355884 - 34355757
Alignment:
96 aactctagagtgaagtttgttaggcgacaagccaatgaggttgctcatattcttgtaggagaagccacattactagctagtcccaccatttattttcata 195  Q
    |||||||| ||||||||||||| |||| ||||||| ||||||||||||  ||||| | ||||| |||  ||||||||||||||| |  |||||||| |||    
34355884 aactctagggtgaagtttgttatgcgaaaagccaacgaggttgctcatgctcttgcaagagaaaccatgttactagctagtcccgctgtttattttgata 34355785  T
196 tgcccgaatgtattgaatctcttattat 223  Q
    | ||| | ||||||||| ||||||||||    
34355784 tacccaattgtattgaaactcttattat 34355757  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 93 - 227
Target Start/End: Complemental strand, 30141081 - 30140947
Alignment:
93 accaactctagagtgaagtttgttaggcgacaagccaatgaggttgctcatattcttgtaggagaagccacattactagctagtcccaccatttattttc 192  Q
    ||||||||||| ||| ||||||||||||||||||| |||| ||| | ||| | ||||| |   ||||||||||| || ||||||||| | || |||||||    
30141081 accaactctagggtggagtttgttaggcgacaagctaatgtggtggatcacactcttgcaaaggaagccacatttctcgctagtcccgctatctattttc 30140982  T
193 atatgcccgaatgtattgaatctcttattattaat 227  Q
    |||| ||| | ||||||||| || | |||||||||    
30140981 atatacccaattgtattgaaactttgattattaat 30140947  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 96 - 223
Target Start/End: Complemental strand, 1493382 - 1493255
Alignment:
96 aactctagagtgaagtttgttaggcgacaagccaatgaggttgctcatattcttgtaggagaagccacattactagctagtcccaccatttattttcata 195  Q
    |||||||| ||| |||||||||||||||||||||| | ||||||||||  ||||| | |||| ||||| |   ||||||||||| || |||||||  |||    
1493382 aactctagggtggagtttgttaggcgacaagccaacgcggttgctcatgctcttgcaagagaggccacgtctttagctagtcccgccgtttatttcgata 1493283  T
196 tgcccgaatgtattgaatctcttattat 223  Q
    | ||| | | ||||||| || |||||||    
1493282 tacccaattatattgaaactattattat 1493255  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 96 - 227
Target Start/End: Original strand, 16890210 - 16890341
Alignment:
96 aactctagagtgaagtttgttaggcgacaagccaatgaggttgctcatattcttgtaggagaagccacattactagctagtcccaccatttattttcata 195  Q
    |||||||| ||| |||||||||||||||||  ||| | ||||||||||  ||||| | ||||||||||||   || ||||| || || |||||||| |||    
16890210 aactctagggtggagtttgttaggcgacaaagcaacgcggttgctcatgctcttgcaagagaagccacatctttaactagtaccgccgtttattttgata 16890309  T
196 tgcccgaatgtattgaatctcttattattaat 227  Q
    | ||| | ||| ||||| ||||| ||||||||    
16890310 tacccaattgttttgaaactcttgttattaat 16890341  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 96 - 143
Target Start/End: Original strand, 9959227 - 9959274
Alignment:
96 aactctagagtgaagtttgttaggcgacaagccaatgaggttgctcat 143  Q
    |||||||| ||| |||||||||||||||||||||| | ||||||||||    
9959227 aactctagggtggagtttgttaggcgacaagccaacgcggttgctcat 9959274  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 184 - 227
Target Start/End: Original strand, 13768241 - 13768284
Alignment:
184 tttattttcatatgcccgaatgtattgaatctcttattattaat 227  Q
    |||||||| |||| ||||| ||||||||||||||||||||||||    
13768241 tttatttttatatacccgattgtattgaatctcttattattaat 13768284  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 96 - 213
Target Start/End: Original strand, 13825472 - 13825589
Alignment:
96 aactctagagtgaagtttgttaggcgacaagccaatgaggttgctcatattcttgtaggagaagccacattactagctagtcccaccatttattttcata 195  Q
    |||| ||| ||| |||||||||||||||||||||| | |||||||||| | |||| | |||||| ||  ||   || |||| |||| ||||||| | |||    
13825472 aactttagtgtggagtttgttaggcgacaagccaacgcggttgctcatgtacttgcaagagaagtcatgttctaagttagttccactatttattatgata 13825571  T
196 tgcccgaatgtattgaat 213  Q
    | | ||||||||||||||    
13825572 tactcgaatgtattgaat 13825589  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 75; Significance: 1e-34; HSPs: 17)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 93 - 227
Target Start/End: Original strand, 13686005 - 13686139
Alignment:
93 accaactctagagtgaagtttgttaggcgacaagccaatgaggttgctcatattcttgtaggagaagccacattactagctagtcccaccatttattttc 192  Q
    ||||||||||| ||| ||||||||||||||||||| || | |||||||||| |||||| | |||||| ||| ||||||||||||||||   |||||||||    
13686005 accaactctagggtggagtttgttaggcgacaagcaaacggggttgctcatgttcttgcaagagaagtcacgttactagctagtcccattgtttattttc 13686104  T
193 atatgcccgaatgtattgaatctcttattattaat 227  Q
    |||| ||||| ||||||||||||||||||||||||    
13686105 atatacccgattgtattgaatctcttattattaat 13686139  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 93 - 227
Target Start/End: Complemental strand, 54027845 - 54027711
Alignment:
93 accaactctagagtgaagtttgttaggcgacaagccaatgaggttgctcatattcttgtaggagaagccacattactagctagtcccaccatttattttc 192  Q
    ||||||||||| ||| ||||| ||||||||||||| |||| ||| ||||| | ||||||||| ||||||||||| || |||| |||| | ||||||||||    
54027845 accaactctagggtggagttttttaggcgacaagctaatgtggtggctcacactcttgtaggggaagccacatttctcgctactcccgctatttattttc 54027746  T
193 atatgcccgaatgtattgaatctcttattattaat 227  Q
    |||| ||| | | ||||||| || | |||||||||    
54027745 atatacccaattatattgaaactttgattattaat 54027711  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 152 - 227
Target Start/End: Original strand, 4462628 - 4462703
Alignment:
152 aggagaagccacattactagctagtcccaccatttattttcatatgcccgaatgtattgaatctcttattattaat 227  Q
    ||||||||||||||||||| |||||||||| ||||||||||||||  | |||||||||||| || |||||||||||    
4462628 aggagaagccacattactaactagtcccacaatttattttcatatatctgaatgtattgaaacttttattattaat 4462703  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 94 - 227
Target Start/End: Complemental strand, 16582480 - 16582347
Alignment:
94 ccaactctagagtgaagtttgttaggcgacaagccaatgaggttgctcatattcttgtaggagaagccacattactagctagtcccaccatttattttca 193  Q
    |||||| ||| ||| |||||||  ||||||||||||| |||| |||||||  ||||| | |||||| ||| |||||||||||||||||| |||||||| |    
16582480 ccaactttagggtggagtttgtcgggcgacaagccaacgaggctgctcatgctcttgcaagagaagtcacgttactagctagtcccaccgtttattttga 16582381  T
194 tatgcccgaatgtattgaatctcttattattaat 227  Q
     || |||   ||||||||| || |||||||||||    
16582380 aatacccagttgtattgaaactattattattaat 16582347  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 93 - 226
Target Start/End: Complemental strand, 37061192 - 37061059
Alignment:
93 accaactctagagtgaagtttgttaggcgacaagccaatgaggttgctcatattcttgtaggagaagccacattactagctagtcccaccatttattttc 192  Q
    ||||||||||| ||| |||||| |||| ||||| | |||| |||||||||| | |||| | |||||||||  || ||||||||||||    ||||||||     
37061192 accaactctagggtggagtttgctaggtgacaaacaaatgtggttgctcatgtgcttgcaagagaagccatgtttctagctagtcccgttgtttatttta 37061093  T
193 atatgcccgaatgtattgaatctcttattattaa 226  Q
    | || ||||| |||||||||||||||||||||||    
37061092 acatacccgattgtattgaatctcttattattaa 37061059  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 96 - 223
Target Start/End: Complemental strand, 20527919 - 20527792
Alignment:
96 aactctagagtgaagtttgttaggcgacaagccaatgaggttgctcatattcttgtaggagaagccacattactagctagtcccaccatttattttcata 195  Q
    |||||||| ||| ||||||||||||| ||||| || | ||||||||||  ||||| | |||| |||   ||||| ||||||||| ||||||||| | |||    
20527919 aactctagggtggagtttgttaggcggcaagctaacggggttgctcatgctcttgcaagagaggccttgttactcgctagtcccgccatttattatgata 20527820  T
196 tgcccgaatgtattgaatctcttattat 223  Q
    | ||||| ||||||||| ||||||||||    
20527819 tacccgattgtattgaaactcttattat 20527792  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 96 - 223
Target Start/End: Original strand, 55227612 - 55227739
Alignment:
96 aactctagagtgaagtttgttaggcgacaagccaatgaggttgctcatattcttgtaggagaagccacattactagctagtcccaccatttattttcata 195  Q
    |||||||| ||| ||||||||||||||||| |||| | ||||||||||  ||||| | | || |||||||   ||||||||||| || |||||||| |||    
55227612 aactctagggtggagtttgttaggcgacaaaccaacgtggttgctcatgctcttgcaagggaggccacatctttagctagtcccgccgtttattttaata 55227711  T
196 tgcccgaatgtattgaatctcttattat 223  Q
    | ||| | ||||||||| ||||||||||    
55227712 tacccaattgtattgaaactcttattat 55227739  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 96 - 223
Target Start/End: Original strand, 30859363 - 30859490
Alignment:
96 aactctagagtgaagtttgttaggcgacaagccaatgaggttgctcatattcttgtaggagaagccacattactagctagtcccaccatttattttcata 195  Q
    |||||||| ||| |||||||||||||||||||||| | ||||||||||  ||||| | | || ||||| |   || |||||||| || |||||||| |||    
30859363 aactctagggtggagtttgttaggcgacaagccaacgtggttgctcatgctcttgcaagggaggccacgtctttaactagtcccgccgtttattttaata 30859462  T
196 tgcccgaatgtattgaatctcttattat 223  Q
    | ||| | ||||||||| ||||||||||    
30859463 tacccaattgtattgaaactcttattat 30859490  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 93 - 227
Target Start/End: Original strand, 12355221 - 12355355
Alignment:
93 accaactctagagtgaagtttgttaggcgacaagccaatgaggttgctcatattcttgtaggagaagccacattactagctagtcccaccatttattttc 192  Q
    ||||||||||| ||| ||||||||||||||||||  |||| ||| ||||| | ||||  |   ||| ||||||| || ||||||||||| || |||||||    
12355221 accaactctagggtggagtttgttaggcgacaaggtaatgtggtggctcacactcttccaaaggaaaccacatttctcgctagtcccactatctattttc 12355320  T
193 atatgcccgaatgtattgaatctcttattattaat 227  Q
    |||| ||| | ||||||||| || | |||||||||    
12355321 atatacccaattgtattgaaactttgattattaat 12355355  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 93 - 227
Target Start/End: Complemental strand, 27087590 - 27087456
Alignment:
93 accaactctagagtgaagtttgttaggcgacaagccaatgaggttgctcatattcttgtaggagaagccacattactagctagtcccaccatttattttc 192  Q
    ||||||||||| ||| ||||||||||||||||||| |||| ||| | ||| | ||||| |   ||||||||||| || ||||||||| | || |||||||    
27087590 accaactctagggtggagtttgttaggcgacaagctaatgtggtgggtcacactcttgcaaaggaagccacatttctcgctagtcccgctatctattttc 27087491  T
193 atatgcccgaatgtattgaatctcttattattaat 227  Q
    |||| | | | ||||||||| || | |||||||||    
27087490 atatactcaattgtattgaaactttgattattaat 27087456  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 96 - 171
Target Start/End: Complemental strand, 16431495 - 16431420
Alignment:
96 aactctagagtgaagtttgttaggcgacaagccaatgaggttgctcatattcttgtaggagaagccacattactag 171  Q
    |||||||| ||| ||||||||||||||||| |||| ||||||| ||||  ||||| | |||||||||| |||||||    
16431495 aactctagggtggagtttgttaggcgacaaaccaacgaggttgttcatgctcttgcaagagaagccacgttactag 16431420  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 93 - 196
Target Start/End: Complemental strand, 27066683 - 27066580
Alignment:
93 accaactctagagtgaagtttgttaggcgacaagccaatgaggttgctcatattcttgtaggagaagccacattactagctagtcccaccatttattttc 192  Q
    ||||||||||| ||| ||||||||||||||||||| |||| ||| | ||| | ||||| |   ||||||||||| || ||||||||| | || |||||||    
27066683 accaactctagggtggagtttgttaggcgacaagctaatgtggtgggtcacactcttgcaaaggaagccacatttctcgctagtcccgctatctattttc 27066584  T
193 atat 196  Q
    ||||    
27066583 atat 27066580  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 93 - 196
Target Start/End: Complemental strand, 27066877 - 27066774
Alignment:
93 accaactctagagtgaagtttgttaggcgacaagccaatgaggttgctcatattcttgtaggagaagccacattactagctagtcccaccatttattttc 192  Q
    ||||||||||| ||| ||||||||||||||||||| |||| ||| | ||| | ||||| |   ||||||||||| || ||||||||| | || |||||||    
27066877 accaactctagggtggagtttgttaggcgacaagctaatgtggtgggtcacactcttgcaaaggaagccacatttctcgctagtcccgctatctattttc 27066778  T
193 atat 196  Q
    ||||    
27066777 atat 27066774  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 93 - 227
Target Start/End: Complemental strand, 27066489 - 27066355
Alignment:
93 accaactctagagtgaagtttgttaggcgacaagccaatgaggttgctcatattcttgtaggagaagccacattactagctagtcccaccatttattttc 192  Q
    ||||||||||| ||| |||||||| |||||||||| |||| ||| | ||| | ||||| |   ||||||||||| || ||||||||| | || |||||||    
27066489 accaactctagggtggagtttgttgggcgacaagctaatgtggtgggtcacactcttgcaaaggaagccacatttctcgctagtcccgctatctattttc 27066390  T
193 atatgcccgaatgtattgaatctcttattattaat 227  Q
    |||| | | | ||||||||| || | |||||||||    
27066389 atatactcaattgtattgaaactttgattattaat 27066355  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 112 - 167
Target Start/End: Original strand, 35765943 - 35765998
Alignment:
112 ttgttaggcgacaagccaatgaggttgctcatattcttgtaggagaagccacatta 167  Q
    |||| ||||||||| ||||||||||||||||| | || | ||||||||||||||||    
35765943 ttgtgaggcgacaatccaatgaggttgctcatgtgctcgcaggagaagccacatta 35765998  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 94 - 179
Target Start/End: Original strand, 34301807 - 34301892
Alignment:
94 ccaactctagagtgaagtttgttaggcgacaagccaatgaggttgctcatattcttgtaggagaagccacattactagctagtccc 179  Q
    |||||||| | ||| |||| |||||||||||| | |||| ||| ||||||| ||||| |  ||| ||||||||| |||||||||||    
34301807 ccaactctcgggtggagttcgttaggcgacaaacaaatgcggtagctcataatcttgcaaaagaggccacattaatagctagtccc 34301892  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 96 - 176
Target Start/End: Original strand, 28860789 - 28860869
Alignment:
96 aactctagagtgaagtttgttaggcgacaagccaatgaggttgctcatattcttgtaggagaagccacattactagctagt 176  Q
    |||||| | ||| |||||||||||||||||||||||| ||| ||||| | ||| |   |||| ||||||||| ||||||||    
28860789 aactctcgggtggagtttgttaggcgacaagccaatgtggtagctcacactctcgctagagaggccacattattagctagt 28860869  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 55; Significance: 1e-22; HSPs: 17)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 93 - 227
Target Start/End: Original strand, 49499407 - 49499541
Alignment:
93 accaactctagagtgaagtttgttaggcgacaagccaatgaggttgctcatattcttgtaggagaagccacattactagctagtcccaccatttattttc 192  Q
    ||||||||||| ||| |||||| |||||||||||| |||| || ||||||| |||||| | |||||||||| || |||||||||| |   |||||||||     
49499407 accaactctagggtggagtttgctaggcgacaagcaaatgtggctgctcatgttcttgcaagagaagccacgtttctagctagtctcgttatttatttta 49499506  T
193 atatgcccgaatgtattgaatctcttattattaat 227  Q
    | ||  |||| ||||||||||||||||||||||||    
49499507 acatatccgattgtattgaatctcttattattaat 49499541  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 96 - 227
Target Start/End: Complemental strand, 19603059 - 19602928
Alignment:
96 aactctagagtgaagtttgttaggcgacaagccaatgaggttgctcatattcttgtaggagaagccacattactagctagtcccaccatttattttcata 195  Q
    |||||||| ||| ||||||||||| |||||| ||| | ||||||||||| ||||| | ||||||| || ||  |||||||||||| |||||||||  |||    
19603059 aactctagggtggagtttgttaggtgacaaggcaacgcggttgctcatactcttgcaagagaagcgacgtttttagctagtcccagcatttatttcgata 19602960  T
196 tgcccgaatgtattgaatctcttattattaat 227  Q
    |  |||| |||||| |||||||||||||||||    
19602959 tatccgattgtatttaatctcttattattaat 19602928  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 93 - 224
Target Start/End: Original strand, 18357104 - 18357236
Alignment:
93 accaactctagagtgaagtttgttaggcgacaagccaatgagg-ttgctcatattcttgtaggagaagccacattactagctagtcccaccatttatttt 191  Q
    ||||||||||| ||| ||||||||||| || |||||||   || ||||||||  ||||| |||||||||||| |||||||||| | ||    ||||||||    
18357104 accaactctagggtggagtttgttaggtgataagccaaacgggattgctcatgctcttgcaggagaagccacgttactagctaattccgttgtttatttt 18357203  T
192 catatgcccgaatgtattgaatctcttattatt 224  Q
     |||| ||||||| |||||||||||||||||||    
18357204 gatatacccgaatatattgaatctcttattatt 18357236  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 135 - 227
Target Start/End: Original strand, 36144765 - 36144857
Alignment:
135 gttgctcatattcttgtaggagaagccacattactagctagtcccaccatttattttcatatgcccgaatgtattgaatctcttattattaat 227  Q
    ||||||||| |||||| | |||| ||||  |||||| |||||||||| |||||||||||||| ||||| ||||||||| ||||| ||||||||    
36144765 gttgctcatgttcttgcacgagaggccatgttactaactagtcccactatttattttcatatacccgattgtattgaacctcttgttattaat 36144857  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 96 - 223
Target Start/End: Complemental strand, 6006175 - 6006048
Alignment:
96 aactctagagtgaagtttgttaggcgacaagccaatgaggttgctcatattcttgtaggagaagccacattactagctagtcccaccatttattttcata 195  Q
    |||||||| ||| |||||||||||||||||||||| | |||| |||||  ||||| | | |||||||| |   ||||||||||| || |||||||| |||    
6006175 aactctagggtggagtttgttaggcgacaagccaacgtggtttctcatgctcttgcaagggaagccacgtctttagctagtcccgccgtttattttaata 6006076  T
196 tgcccgaatgtattgaatctcttattat 223  Q
    | ||| | ||||||||| ||||||||||    
6006075 tacccaattgtattgaaactcttattat 6006048  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 109 - 223
Target Start/End: Complemental strand, 29373079 - 29372965
Alignment:
109 agtttgttaggcgacaagccaatgaggttgctcatattcttgtaggagaagccacattactagctagtcccaccatttattttcatatgcccgaatgtat 208  Q
    ||||||||||||||||| |||| |||||||| |||  ||||  | |||||| ||| ||||||||||||||     |||||||| || | |||||||||||    
29373079 agtttgttaggcgacaaaccaacgaggttgcccatgctctttcaagagaagtcacgttactagctagtccggttgtttattttaatttacccgaatgtat 29372980  T
209 tgaatctcttattat 223  Q
    |||| ||||||||||    
29372979 tgaaactcttattat 29372965  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 94 - 179
Target Start/End: Complemental strand, 16739572 - 16739487
Alignment:
94 ccaactctagagtgaagtttgttaggcgacaagccaatgaggttgctcatattcttgtaggagaagccacattactagctagtccc 179  Q
    |||||||| | ||| ||||||||||||||||| |||| ||| ||||| ||  ||||| | |||||||||| |||||||||||||||    
16739572 ccaactctcgggtggagtttgttaggcgacaaaccaacgagattgctaatgctcttgcaagagaagccacgttactagctagtccc 16739487  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 96 - 215
Target Start/End: Complemental strand, 31661113 - 31660994
Alignment:
96 aactctagagtgaagtttgttaggcgacaagccaatgaggttgctcatattcttgtaggagaagccacattactagctagtcccaccatttattttcata 195  Q
    |||||||| ||| |||||||||||||||||||||| | ||||||||||  ||||| | |||| | ||| ||  || |||||||| || |||||| | |||    
31661113 aactctagggtggagtttgttaggcgacaagccaacgcggttgctcatgctcttgcacgagaggtcacttttttatctagtcccgccgtttattatgata 31661014  T
196 tgcccgaatgtattgaatct 215  Q
    | ||| | ||||||||||||    
31661013 tacccaattgtattgaatct 31660994  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 96 - 215
Target Start/End: Original strand, 31935240 - 31935359
Alignment:
96 aactctagagtgaagtttgttaggcgacaagccaatgaggttgctcatattcttgtaggagaagccacattactagctagtcccaccatttattttcata 195  Q
    |||||||| ||| |||||||||||||||||||||| |  |||||||||  ||||| | |||| ||||| |   ||||||||||| || |||||| | |||    
31935240 aactctagggtggagtttgttaggcgacaagccaacgcagttgctcatgctcttgcacgagaggccacgtctttagctagtcccgccgtttattatgata 31935339  T
196 tgcccgaatgtattgaatct 215  Q
    | ||| | ||||||||||||    
31935340 tacccaattgtattgaatct 31935359  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 96 - 215
Target Start/End: Original strand, 31973498 - 31973617
Alignment:
96 aactctagagtgaagtttgttaggcgacaagccaatgaggttgctcatattcttgtaggagaagccacattactagctagtcccaccatttattttcata 195  Q
    |||||||  ||| |||||||||||||||||||||| | ||||||||||  ||||| | |||| ||||| |   ||||||||||| || |||||| | |||    
31973498 aactctatggtggagtttgttaggcgacaagccaacgcggttgctcatgctcttgcacgagaggccacgtctttagctagtcccgccgtttattatgata 31973597  T
196 tgcccgaatgtattgaatct 215  Q
    | ||| | ||||||||||||    
31973598 tacccaattgtattgaatct 31973617  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 96 - 224
Target Start/End: Original strand, 18342634 - 18342763
Alignment:
96 aactctagagtgaagtttgttaggcgacaagcc-aatgaggttgctcatattcttgtaggagaagccacattactagctagtcccaccatttattttcat 194  Q
    |||||||| |||||||||||||| ||||||||| || | | ||||||||  | ||| || |||||| || |||||||||||| ||    |||||||| ||    
18342634 aactctagggtgaagtttgttagacgacaagccaaacgggattgctcatgctattgcagaagaagctacgttactagctagttccgttgtttattttaat 18342733  T
195 atgcccgaatgtattgaatctcttattatt 224  Q
    || | |||||||||  ||||||||||||||    
18342734 atactcgaatgtataaaatctcttattatt 18342763  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 96 - 223
Target Start/End: Original strand, 17790152 - 17790279
Alignment:
96 aactctagagtgaagtttgttaggcgacaagccaatgaggttgctcatattcttgtaggagaagccacattactagctagtcccaccatttattttcata 195  Q
    |||||||| ||| |||||||||||||||||||||| | |||||||||   ||||| | | || ||||| |   |||||||||   || |||||||| |||    
17790152 aactctagggtggagtttgttaggcgacaagccaacgtggttgctcacgctcttgcaagggaggccacgtctttagctagtctagccgtttattttaata 17790251  T
196 tgcccgaatgtattgaatctcttattat 223  Q
    | ||| | ||||||||| ||||||||||    
17790252 tacccaattgtattgaaactcttattat 17790279  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 96 - 223
Target Start/End: Original strand, 19098594 - 19098721
Alignment:
96 aactctagagtgaagtttgttaggcgacaagccaatgaggttgctcatattcttgtaggagaagccacattactagctagtcccaccatttattttcata 195  Q
    |||||||| ||| |||||||||||||||||||||| | |||||||||   ||||| | | || ||||| |   |||||||||   || |||||||| |||    
19098594 aactctagggtggagtttgttaggcgacaagccaacgtggttgctcacgctcttgcaagggaggccacgtctttagctagtctagccgtttattttaata 19098693  T
196 tgcccgaatgtattgaatctcttattat 223  Q
    | ||| | ||||||||| ||||||||||    
19098694 tacccaattgtattgaaactcttattat 19098721  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 96 - 143
Target Start/End: Original strand, 31228238 - 31228285
Alignment:
96 aactctagagtgaagtttgttaggcgacaagccaatgaggttgctcat 143  Q
    |||||||| ||| |||||||||||||||||||||| | ||||||||||    
31228238 aactctagggtggagtttgttaggcgacaagccaacgtggttgctcat 31228285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 94 - 189
Target Start/End: Original strand, 31809160 - 31809255
Alignment:
94 ccaactctagagtgaagtttgttaggcgacaagccaatgaggttgctcatattcttgtaggagaagccacattactagctagtcccaccatttatt 189  Q
    |||||||||| ||| |||||||||||||||||||||| | ||| ||||||  ||||| | |||| ||||| |   ||||||||||| || ||||||    
31809160 ccaactctagggtggagtttgttaggcgacaagccaacgcggtggctcatcctcttgcacgagaggccacgtctttagctagtcccgccgtttatt 31809255  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 96 - 165
Target Start/End: Original strand, 53437536 - 53437605
Alignment:
96 aactctagagtgaagtttgttaggcgacaagccaatgaggttgctcatattcttgtaggagaagccacat 165  Q
    |||||||| ||| ||||||||||| |||||| ||||| | ||||||||  ||||| | ||||||||||||    
53437536 aactctagggtggagtttgttaggagacaagtcaatgcgattgctcatgctcttgcaagagaagccacat 53437605  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 96 - 176
Target Start/End: Complemental strand, 18765733 - 18765653
Alignment:
96 aactctagagtgaagtttgttaggcgacaagccaatgaggttgctcatattcttgtaggagaagccacattactagctagt 176  Q
    |||||| | ||| |||||||||||||||||||||||  ||| ||||||| ||| |   |||| ||||||||| ||||||||    
18765733 aactctcgggtggagtttgttaggcgacaagccaatttggtagctcatactctcgctagagaggccacattaatagctagt 18765653  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0643 (Bit Score: 47; Significance: 6e-18; HSPs: 1)
Name: scaffold0643
Description:

Target: scaffold0643; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 93 - 227
Target Start/End: Original strand, 1045 - 1179
Alignment:
93 accaactctagagtgaagtttgttaggcgacaagccaatgaggttgctcatattcttgtaggagaagccacattactagctagtcccaccatttattttc 192  Q
    ||||||||||| ||| ||||||||||||||||| | |||| ||| ||||| | ||||  | | ||||||||||| || ||||||||| | ||||||||||    
1045 accaactctagggtggagtttgttaggcgacaaactaatgtggtggctcacaatcttacaagggaagccacatttctcgctagtcccgctatttattttc 1144  T
193 atatgcccgaatgtattgaatctcttattattaat 227  Q
    |||| ||| | |||||||||| | | |||||||||    
1145 atatacccaattgtattgaatgtttgattattaat 1179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0789 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0789
Description:

Target: scaffold0789; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 96 - 143
Target Start/End: Complemental strand, 4356 - 4309
Alignment:
96 aactctagagtgaagtttgttaggcgacaagccaatgaggttgctcat 143  Q
    |||||||| ||| |||||||||||||||||||||| ||||||||||||    
4356 aactctagggtggagtttgttaggcgacaagccaaagaggttgctcat 4309  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0040 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold0040
Description:

Target: scaffold0040; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 96 - 143
Target Start/End: Complemental strand, 62628 - 62581
Alignment:
96 aactctagagtgaagtttgttaggcgacaagccaatgaggttgctcat 143  Q
    |||||||| ||| |||||||||||||||||||||| | ||||||||||    
62628 aactctagggtggagtttgttaggcgacaagccaacgtggttgctcat 62581  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0011 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold0011
Description:

Target: scaffold0011; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 96 - 143
Target Start/End: Complemental strand, 191144 - 191097
Alignment:
96 aactctagagtgaagtttgttaggcgacaagccaatgaggttgctcat 143  Q
    |||||||| ||| |||||||||||||||||||||| | ||||||||||    
191144 aactctagggtggagtttgttaggcgacaagccaacgcggttgctcat 191097  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1964 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold1964
Description:

Target: scaffold1964; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 93 - 186
Target Start/End: Original strand, 1109 - 1202
Alignment:
93 accaactctagagtgaagtttgttaggcgacaagccaatgaggttgctcatattcttgtaggagaagccacattactagctagtcccaccattt 186  Q
    ||||||||| | ||| |||||||| |||||||||| |||| ||| ||||| | ||| | ||| ||||||||||| || |||||| |||| ||||    
1109 accaactctcgggtggagtttgttcggcgacaagctaatgtggtggctcacactctcgcaggggaagccacatttctcgctagttccactattt 1202  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 108011 times since January 2019
Visitors: 1329