View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5_16_61 (Length: 150)

Name: J5_16_61
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5_16_61
J5_16_61
[»] chr5 (2 HSPs)
chr5 (40-150)||(32932557-32932667)
chr5 (1-47)||(32932663-32932709)


Alignment Details
Target: chr5 (Bit Score: 111; Significance: 2e-56; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 111; E-Value: 2e-56
Query Start/End: Original strand, 40 - 150
Target Start/End: Original strand, 32932557 - 32932667
Alignment:
40 attaataacgtctggcccaacattatttaagtaagaatttgaactcgggttttcccaaacaatttgtctttaactgaaactcattaaggagttcaatcac 139  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32932557 attaataacgtctggcccaacattatttaagtaagaatttgaactcgggttttcccaaacaatttgtctttaactgaaactcattaaggagttcaatcac 32932656  T
140 ttggttggtta 150  Q
    |||||||||||    
32932657 ttggttggtta 32932667  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 43; E-Value: 8e-16
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 32932663 - 32932709
Alignment:
1 ggttaaattgaaatagctattaaatagcgtaatgtatgtattaataa 47  Q
    ||||||||||||||||||||||||||| |||||||||||||||||||    
32932663 ggttaaattgaaatagctattaaatagtgtaatgtatgtattaataa 32932709  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 108460 times since January 2019
Visitors: 1329