View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5_16_66 (Length: 244)

Name: J5_16_66
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5_16_66
J5_16_66
[»] chr5 (6 HSPs)
chr5 (17-241)||(36044825-36045048)
chr5 (66-151)||(19741587-19741672)
chr5 (49-152)||(19237663-19237766)
chr5 (17-152)||(29754963-29755096)
chr5 (66-151)||(2157834-2157919)
chr5 (21-149)||(22292379-22292506)
[»] chr8 (9 HSPs)
chr8 (21-241)||(26931874-26932093)
chr8 (68-152)||(2246780-2246864)
chr8 (84-149)||(17837229-17837294)
chr8 (21-149)||(14505721-14505848)
chr8 (17-149)||(34723862-34723993)
chr8 (17-149)||(37590046-37590177)
chr8 (17-126)||(953693-953801)
chr8 (102-149)||(1186545-1186592)
chr8 (49-136)||(10601107-10601194)
[»] chr1 (11 HSPs)
chr1 (17-241)||(5185281-5185503)
chr1 (54-151)||(41117187-41117284)
chr1 (17-152)||(24065210-24065344)
chr1 (21-149)||(40490027-40490154)
chr1 (17-152)||(29115408-29115542)
chr1 (66-152)||(13288084-13288170)
chr1 (49-128)||(35151231-35151310)
chr1 (72-149)||(24427558-24427635)
chr1 (97-149)||(10771217-10771269)
chr1 (102-149)||(9361767-9361814)
chr1 (49-125)||(9928977-9929053)
[»] chr7 (8 HSPs)
chr7 (17-223)||(48770038-48770243)
chr7 (66-151)||(15633227-15633312)
chr7 (30-149)||(17238695-17238813)
chr7 (17-152)||(33611042-33611176)
chr7 (67-151)||(13015021-13015105)
chr7 (51-149)||(2175046-2175144)
chr7 (17-149)||(32480215-32480346)
chr7 (66-152)||(48100797-48100883)
[»] chr2 (10 HSPs)
chr2 (17-152)||(11553324-11553458)
chr2 (17-152)||(11818452-11818586)
chr2 (66-150)||(36641358-36641442)
chr2 (17-152)||(14231020-14231154)
chr2 (84-149)||(11502322-11502387)
chr2 (21-149)||(16206539-16206666)
chr2 (65-149)||(27267944-27268028)
chr2 (49-152)||(10973588-10973691)
chr2 (17-152)||(33650874-33651008)
chr2 (30-149)||(44886295-44886413)
[»] chr6 (6 HSPs)
chr6 (17-152)||(16416598-16416732)
chr6 (17-240)||(23508859-23509081)
chr6 (21-149)||(34355757-34355884)
chr6 (17-152)||(30140947-30141081)
chr6 (102-149)||(1493335-1493382)
chr6 (102-149)||(9959227-9959274)
[»] chr4 (11 HSPs)
chr4 (17-152)||(13686005-13686139)
chr4 (49-152)||(54027742-54027845)
chr4 (17-93)||(4462628-4462703)
chr4 (17-151)||(16582347-16582480)
chr4 (21-149)||(55227612-55227739)
chr4 (18-152)||(37061059-37061192)
chr4 (21-149)||(30859363-30859490)
chr4 (74-149)||(16431420-16431495)
chr4 (49-152)||(27066580-27066683)
chr4 (49-152)||(27066774-27066877)
chr4 (49-152)||(27087487-27087590)
[»] chr3 (8 HSPs)
chr3 (17-152)||(49499407-49499541)
chr3 (17-149)||(19602928-19603059)
chr3 (21-149)||(6006048-6006175)
chr3 (17-110)||(36144765-36144857)
chr3 (66-151)||(16739487-16739572)
chr3 (20-152)||(18357104-18357236)
chr3 (102-149)||(31228238-31228285)
chr3 (102-149)||(31661066-31661113)
[»] scaffold0643 (1 HSPs)
scaffold0643 (17-152)||(1045-1179)
[»] scaffold0789 (1 HSPs)
scaffold0789 (102-149)||(4309-4356)
[»] scaffold0040 (1 HSPs)
scaffold0040 (102-149)||(62581-62628)
[»] scaffold0011 (1 HSPs)
scaffold0011 (102-149)||(191097-191144)


Alignment Details
Target: chr5 (Bit Score: 180; Significance: 3e-97; HSPs: 6)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 17 - 241
Target Start/End: Complemental strand, 36045048 - 36044825
Alignment:
17 attaataataagagattcaataccattcgggcatatgaaaataaatggtgggactagctagtaatgcggcttctcctacaagaatatgagcaacctcatt 116  Q
    ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
36045048 attaataataagagattcaatac-attcgggcatatgaaaataaatggtgggactagctagtaatgtggcttctcctacaagaatatgagcaacctcatt 36044950  T
117 ggcttgtcgcctaanaaacttcactctagagttggtnnnnnnntaactaactagagtacgacaggaagaaatnatgcacctaaattcaaagtagtcgtct 216  Q
    |||||||||||||| |||||||||||||||||||||       ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
36044949 ggcttgtcgcctaacaaacttcactctagagttggtaaaaaaataactaactagagtacgacaggaagaaataatgcacctaaattcaaagtagtcgtct 36044850  T
217 tgagtagnatggaaggcatcncaag 241  Q
    ||||||| |||||||||||| ||||    
36044849 tgagtagtatggaaggcatcacaag 36044825  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 66 - 151
Target Start/End: Original strand, 19741587 - 19741672
Alignment:
66 gggactagctagtaatgcggcttctcctacaagaatatgagcaacctcattggcttgtcgcctaanaaacttcactctagagttgg 151  Q
    ||||||||||||||||| |||||||| | |||||  |||||||||| | || ||||||||||||| ||| ||||| ||||||||||    
19741587 gggactagctagtaatgtggcttctcttgcaagagcatgagcaaccccgttagcttgtcgcctaacaaatttcaccctagagttgg 19741672  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 49 - 152
Target Start/End: Complemental strand, 19237766 - 19237663
Alignment:
49 atatgaaaataaatggtgggactagctagtaatgcggcttctcctacaagaatatgagcaacctcattggcttgtcgcctaanaaacttcactctagagt 148  Q
    |||||||||||||  |||| | |||||||||  | | | |||| | |||||| ||||||||||||||| ||||||||||||| ||||| ||| |||||||    
19237766 atatgaaaataaacagtggaattagctagtagcgtgacctctcttgcaagaacatgagcaacctcatttgcttgtcgcctaataaactccaccctagagt 19237667  T
149 tggt 152  Q
    ||||    
19237666 tggt 19237663  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 17 - 152
Target Start/End: Original strand, 29754963 - 29755096
Alignment:
17 attaataataagagattcaataccattcgggcatatgaaaataaatggtgggactagctagtaatgcggcttctcctacaagaatatgagcaacctcatt 116  Q
    ||||||||| | || |||||||| ||| ||| ||||||||||| || | ||||||||| || |||| |||||||  | ||||| | ||||| ||| ||||    
29754963 attaataatcaaagtttcaatacaatt-gggtatatgaaaatagatagcgggactagcgagaaatgtggcttctt-tgcaagagtgtgagccaccacatt 29755060  T
117 ggcttgtcgcctaanaaacttcactctagagttggt 152  Q
     ||||||||||||| ||||| ||| |||||||||||    
29755061 agcttgtcgcctaacaaactccaccctagagttggt 29755096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 66 - 151
Target Start/End: Original strand, 2157834 - 2157919
Alignment:
66 gggactagctagtaatgcggcttctcctacaagaatatgagcaacctcattggcttgtcgcctaanaaacttcactctagagttgg 151  Q
    ||||||||||||||| | |||||||| | |||||  || ||||| ||| |||||||||||||||| ||||| ||| | ||||||||    
2157834 gggactagctagtaacgtggcttctcttgcaagagcataagcaatctcgttggcttgtcgcctaacaaactccacccgagagttgg 2157919  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 21 - 149
Target Start/End: Complemental strand, 22292506 - 22292379
Alignment:
21 ataataagagattcaataccattcgggcatatgaaaataaatggtgggactagctagtaatgcggcttctcctacaagaatatgagcaacctcattggct 120  Q
    |||||||||| |||||||| ||| ||| |||| |||||||| || |||||||||||   | | ||| || | | |||||  |||||||||| | ||||||    
22292506 ataataagagtttcaatacaatt-gggtatattaaaataaacggcgggactagctaaagacgtggcctcccttgcaagagcatgagcaaccacgttggct 22292408  T
121 tgtcgcctaanaaacttcactctagagtt 149  Q
    |||||||||| ||||| ||| ||||||||    
22292407 tgtcgcctaacaaactccaccctagagtt 22292379  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 100; Significance: 1e-49; HSPs: 9)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 21 - 241
Target Start/End: Original strand, 26931874 - 26932093
Alignment:
21 ataataagagattcaataccattcgggcatatgaaaataaatggtgggactagctagtaatgcggcttctcctacaagaatatgagcaacctcattggct 120  Q
    ||||||||||||||||||| ||||||  |||||||||||||||| | ||||||||||||||| |||||||||| |||||| |||| |||| |||||||||    
26931874 ataataagagattcaatac-attcggatatatgaaaataaatggcgagactagctagtaatgtggcttctcctgcaagaacatgaacaacttcattggct 26931972  T
121 tgtcgcctaanaaacttcactctagagttggtnnnnnnntaactaactagagtacgacaggaagaaatnatgcacctaaattcaaagtagtcgtcttgag 220  Q
    ||| |||||| |||||  || |||||||||||        |||||||||||||||||||||||||||| ||||||| ||||||| || |||||| |  ||    
26931973 tgttgcctaacaaactctaccctagagttggtaaagaaagaactaactagagtacgacaggaagaaataatgcacccaaattcagagcagtcgtatcaag 26932072  T
221 tagnatggaaggcatcncaag 241  Q
    ||| |||||||||||| ||||    
26932073 tagtatggaaggcatcacaag 26932093  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 68 - 152
Target Start/End: Original strand, 2246780 - 2246864
Alignment:
68 gactagctagtaatgcggcttctcctacaagaatatgagcaacctcattggcttgtcgcctaanaaacttcactctagagttggt 152  Q
    |||||||||||||   | |||||||| |||||| |||||||||||| || |||||| |||||| ||||| ||| |||||||||||    
2246780 gactagctagtaacatgacttctcctgcaagaacatgagcaacctcgtttgcttgttgcctaacaaactccaccctagagttggt 2246864  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 84 - 149
Target Start/End: Original strand, 17837229 - 17837294
Alignment:
84 ggcttctcctacaagaatatgagcaacctcattggcttgtcgcctaanaaacttcactctagagtt 149  Q
    |||||||| | ||||| ||||||||||| | |||||||||||||||| ||||| ||| ||||||||    
17837229 ggcttctcttgcaagagtatgagcaaccgcgttggcttgtcgcctaacaaactccaccctagagtt 17837294  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 21 - 149
Target Start/End: Complemental strand, 14505848 - 14505721
Alignment:
21 ataataagagattcaataccattcgggcatatgaaaataaatggtgggactagctagtaatgcggcttctcctacaagaatatgagcaacctcattggct 120  Q
    |||||||||| |||||||| ||| ||| |||| |||||||| || |||||||||||   | | ||| || | | |||||  |||||||||| | ||||||    
14505848 ataataagagtttcaatacaatt-gggtatattaaaataaacggcgggactagctaaagacgtggcctcccttgcaagagcatgagcaaccacgttggct 14505750  T
121 tgtcgcctaanaaacttcactctagagtt 149  Q
    |||||||||| ||||| ||| ||||||||    
14505749 tgtcgcctaacaaactccaccctagagtt 14505721  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 17 - 149
Target Start/End: Original strand, 34723862 - 34723993
Alignment:
17 attaataataagagattcaataccattcgggcatatgaaaataaatggtgggactagctagtaatgcggcttctcctacaagaatatgagcaacctcatt 116  Q
    |||||| |||| ||||||||||| ||| ||| |||| | |||||| || | |||||||||   | | |||||||| | ||||| ||||||||||| | ||    
34723862 attaatcataatagattcaatacaatt-gggtatatcataataaacggcgagactagctaaagacgtggcttctcttgcaagagtatgagcaaccacgtt 34723960  T
117 ggcttgtcgcctaanaaacttcactctagagtt 149  Q
    |||||||||||||| ||||| ||| || |||||    
34723961 ggcttgtcgcctaacaaactccaccctggagtt 34723993  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 17 - 149
Target Start/End: Original strand, 37590046 - 37590177
Alignment:
17 attaataataagagattcaataccattcgggcatatgaaaataaatggtgggactagctagtaatgcggcttctcctacaagaatatgagcaacctcatt 116  Q
    |||||||||||||| |||||||| ||| ||| |||| |||||||| || || ||||||||   | | ||| || | | |||||  |||||||||| | ||    
37590046 attaataataagagtttcaatacaatt-gggtatattaaaataaacggcggaactagctaaagacgtggcctcccttgcaagagcatgagcaaccacgtt 37590144  T
117 ggcttgtcgcctaanaaacttcactctagagtt 149  Q
    |||||||||||||| ||||| ||| ||||||||    
37590145 ggcttgtcgcctaacaaactccaccctagagtt 37590177  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 17 - 126
Target Start/End: Complemental strand, 953801 - 953693
Alignment:
17 attaataataagagattcaataccattcgggcatatgaaaataaatggtgggactagctagtaatgcggcttctcctacaagaatatgagcaacctcatt 116  Q
    |||||||||||||| |||||||| ||| |   || ||||||||||    ||||||||||||||| | | |||||||| |||||| |||||||| ||| ||    
953801 attaataataagaggttcaatacaattagat-atgtgaaaataaacaacgggactagctagtaacgtgacttctcctgcaagaacatgagcaaactcgtt 953703  T
117 ggcttgtcgc 126  Q
     |||||||||    
953702 tgcttgtcgc 953693  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 102 - 149
Target Start/End: Complemental strand, 1186592 - 1186545
Alignment:
102 atgagcaacctcattggcttgtcgcctaanaaacttcactctagagtt 149  Q
    |||||||||| | |||||||||||||||| ||||| ||| ||||||||    
1186592 atgagcaaccacgttggcttgtcgcctaacaaactccaccctagagtt 1186545  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 49 - 136
Target Start/End: Complemental strand, 10601194 - 10601107
Alignment:
49 atatgaaaataaatggtgggactagctagtaatgcggcttctcctacaagaatatgagcaacctcattggcttgtcgcctaanaaact 136  Q
    ||||||| |||||| ||||||||||| || |||| |||||| ||| | ||| | ||||| ||| |||| |||||||||| || |||||    
10601194 atatgaagataaatagtgggactagcgagaaatgtggcttcccctgcgagagtgtgagccaccacattagcttgtcgccgaacaaact 10601107  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 84; Significance: 5e-40; HSPs: 11)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 17 - 241
Target Start/End: Original strand, 5185281 - 5185503
Alignment:
17 attaataataagagattcaataccattcgggcatatgaaaataaatggtgggactagctagtaatgcggcttctcctacaagaatatgagcaacctcatt 116  Q
    ||||||||||||| ||||||||  ||||||| |||| ||||||||||| |||||||||| |||||| | |||||| | |||||| |||| ||||||||||    
5185281 attaataataagatattcaatat-attcgggtatataaaaataaatggcgggactagctggtaatgtgacttctcttgcaagaacatgaacaacctcatt 5185379  T
117 ggcttgtcgcctaanaaacttcactctagagttggtnnnnnnntaactaactagagtacgacaggaagaaatnatgcacctaaattcaaagtagtcgtct 216  Q
    || ||||||| ||| ||||| ||| |||||||||||        || |||||||||||||||| ||| |||| ||||| | ||||||| |||||||||||    
5185380 ggtttgtcgcttaacaaactccaccctagagttggtaaagaaa-aattaactagagtacgacatgaaaaaataatgcatccaaattcagagtagtcgtct 5185478  T
217 tgagtagnatggaaggcatcncaag 241  Q
     |||||| |||||||||||| ||||    
5185479 cgagtagtatggaaggcatcacaag 5185503  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 54 - 151
Target Start/End: Complemental strand, 41117284 - 41117187
Alignment:
54 aaaataaatggtgggactagctagtaatgcggcttctcctacaagaatatgagcaacctcattggcttgtcgcctaanaaacttcactctagagttgg 151  Q
    |||||||| |||||||||||||||||| | |||||||| | |||||  ||||||||||||||||||||||||||||| ||||| ||| | ||||||||    
41117284 aaaataaacggtgggactagctagtaacgtggcttctcttgcaagagcatgagcaacctcattggcttgtcgcctaacaaactccacccgagagttgg 41117187  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 17 - 152
Target Start/End: Complemental strand, 24065344 - 24065210
Alignment:
17 attaataataagagattcaataccattcgggcatatgaaaataaatggtgggactagctagtaatgcggcttctcctacaagaatatgagcaacctcatt 116  Q
    |||||||||||||  |||||||| || |||| || ||||||||||    ||||||||||||||| | |||||||||| |||||| |||||||||||| ||    
24065344 attaataataagaagttcaatacaat-cgggtatgtgaaaataaacaacgggactagctagtaacgtggcttctcctgcaagaacatgagcaacctcgtt 24065246  T
117 ggcttgtcgcctaanaaacttcactctagagttggt 152  Q
     ||||||||||||| ||||| ||| ||| |||||||    
24065245 tgcttgtcgcctaacaaactccaccctaaagttggt 24065210  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 21 - 149
Target Start/End: Original strand, 40490027 - 40490154
Alignment:
21 ataataagagattcaataccattcgggcatatgaaaataaatggtgggactagctagtaatgcggcttctcctacaagaatatgagcaacctcattggct 120  Q
    |||||||||| |||||||  |||| || |||| ||||||||  | ||||||| ||||||| ||| |||||| | |||||  |||||| |||||||||| |    
40490027 ataataagagtttcaatat-attccggtatatcaaaataaacagcgggactaactagtaacgcgacttctcttgcaagagcatgagcgacctcattggtt 40490125  T
121 tgtcgcctaanaaacttcactctagagtt 149  Q
    |||||||||| ||||| ||| ||||||||    
40490126 tgtcgcctaacaaactccaccctagagtt 40490154  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 17 - 152
Target Start/End: Complemental strand, 29115542 - 29115408
Alignment:
17 attaataataagagattcaataccattcgggcatatgaaaataaatggtgggactagctagtaatgcggcttctcctacaagaatatgagcaacctcatt 116  Q
    |||||||||||||| ||| |||| || |||| |||||||||||||      ||||||||||||| | | | |||| |||| ||| |||||||||||| ||    
29115542 attaataataagaggttccatacaat-cgggtatatgaaaataaacaacatgactagctagtaacgtgacctctcttacaggaacatgagcaacctcgtt 29115444  T
117 ggcttgtcgcctaanaaacttcactctagagttggt 152  Q
     |||||||| |||| ||||| ||| |||||||||||    
29115443 tgcttgtcgtctaacaaactacaccctagagttggt 29115408  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 66 - 152
Target Start/End: Complemental strand, 13288170 - 13288084
Alignment:
66 gggactagctagtaatgcggcttctcctacaagaatatgagcaacctcattggcttgtcgcctaanaaacttcactctagagttggt 152  Q
    |||||||||||| |||  |||||||||| |||| | |||||||||| |||| | ||||||||||  ||||| ||| |||||||||||    
13288170 gggactagctagaaatatggcttctcctgcaagcacatgagcaaccgcatttgtttgtcgcctagcaaactccaccctagagttggt 13288084  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 49 - 128
Target Start/End: Complemental strand, 35151310 - 35151231
Alignment:
49 atatgaaaataaatggtgggactagctagtaatgcggcttctcctacaagaatatgagcaacctcattggcttgtcgcct 128  Q
    |||||||||||||| ||||||||||||  |||||||||||||||| | |||  |||| | ||| |||| |||||||||||    
35151310 atatgaaaataaatagtgggactagctgataatgcggcttctcctgctagagcatgaaccaccacatttgcttgtcgcct 35151231  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 72 - 149
Target Start/End: Original strand, 24427558 - 24427635
Alignment:
72 agctagtaatgcggcttctcctacaagaatatgagcaacctcattggcttgtcgcctaanaaacttcactctagagtt 149  Q
    |||||| |||| || ||||| | ||||| ||||||| |||||||||||||||||||||| |||||  || ||||||||    
24427558 agctaggaatgtggtttctcttgcaagagtatgagcgacctcattggcttgtcgcctaataaactcgaccctagagtt 24427635  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 97 - 149
Target Start/End: Complemental strand, 10771269 - 10771217
Alignment:
97 agaatatgagcaacctcattggcttgtcgcctaanaaacttcactctagagtt 149  Q
    ||||||||||| ||| |||||||||||||||||| ||||| ||| | ||||||    
10771269 agaatatgagctaccacattggcttgtcgcctaacaaactccacccgagagtt 10771217  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 102 - 149
Target Start/End: Complemental strand, 9361814 - 9361767
Alignment:
102 atgagcaacctcattggcttgtcgcctaanaaacttcactctagagtt 149  Q
    |||||||||| | |||||||||||||||| ||||| ||| ||||||||    
9361814 atgagcaaccgcgttggcttgtcgcctaacaaactccaccctagagtt 9361767  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 49 - 125
Target Start/End: Complemental strand, 9929053 - 9928977
Alignment:
49 atatgaaaataaatggtgggactagctagtaatgcggcttctcctacaagaatatgagcaacctcattggcttgtcg 125  Q
    ||||||||||| || ||||||||||||| ||||| || ||||||| | |||  |||||| |||||||| | ||||||    
9929053 atatgaaaatatatagtgggactagctaataatgtggtttctcctgctagagcatgagccacctcatttgtttgtcg 9928977  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 80; Significance: 1e-37; HSPs: 8)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 17 - 223
Target Start/End: Complemental strand, 48770243 - 48770038
Alignment:
17 attaataataagagattcaataccattcgggcatatgaaaataaatggtgggactagctagtaatgcggcttctcctacaagaatatgagcaacctcatt 116  Q
    |||||||||||||| |||||||| ||||||| ||||||||||||||||||||||||||| |||||| |||||||||| | |||| |||||||||||||||    
48770243 attaataataagagtttcaatac-attcgggtatatgaaaataaatggtgggactagcttgtaatgtggcttctcctgcgagaacatgagcaacctcatt 48770145  T
117 ggcttgtcgcctaanaaacttcactctagagttggtnnnnnnntaactaactagagtacgacaggaagaaatnatgcacctaaattcaaagtagtcgtct 216  Q
     |||| ||||| || ||||| ||| |||||||||||        | ||||||||||| ||||| |||||||| || || | ||| ||| | |||||||||    
48770144 agcttctcgccgaataaactccaccctagagttggtaaaaaaagagctaactagagtgcgacatgaagaaataatacatccaaactcagaatagtcgtct 48770045  T
217 tgagtag 223  Q
     ||||||    
48770044 cgagtag 48770038  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 66 - 151
Target Start/End: Complemental strand, 15633312 - 15633227
Alignment:
66 gggactagctagtaatgcggcttctcctacaagaatatgagcaacctcattggcttgtcgcctaanaaacttcactctagagttgg 151  Q
    ||||||||||||||| | |||||||| | ||||| |||||||||||||||||||||||||||||| ||||| ||| | ||||||||    
15633312 gggactagctagtaacgtggcttctcttgcaagagtatgagcaacctcattggcttgtcgcctaacaaactccacccgagagttgg 15633227  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 30 - 149
Target Start/End: Original strand, 17238695 - 17238813
Alignment:
30 gattcaataccattcgggcatatgaaaataaatggtgggactagctagtaatgcggcttctcctacaagaatatgagcaacctcattggcttgtcgccta 129  Q
    |||||||||| ||||||| |||| | ||||||| |||||||||| ||  |||| |||||||| | ||||   |||||||||| | |||||||||||||||    
17238695 gattcaatac-attcgggtatatcataataaatagtgggactagttaagaatgtggcttctcttgcaagtgcatgagcaaccgcgttggcttgtcgccta 17238793  T
130 anaaacttcactctagagtt 149  Q
    | ||||| ||| ||||||||    
17238794 acaaactccaccctagagtt 17238813  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 17 - 152
Target Start/End: Original strand, 33611042 - 33611176
Alignment:
17 attaataataagagattcaataccattcgggcatatgaaaataaatggtgggactagctagtaatgcggcttctcctacaagaatatgagcaacctcatt 116  Q
    |||||||||||||| |||||||| || |||| |||||||||||||    ||||| |||||||||   ||| |||||| |||||| |||| |||||   ||    
33611042 attaataataagaggttcaatacaat-cgggtatatgaaaataaacaacgggaccagctagtaacatggcatctcctgcaagaacatgaacaaccctgtt 33611140  T
117 ggcttgtcgcctaanaaacttcactctagagttggt 152  Q
     ||||||||||||| ||||| ||| |||||||||||    
33611141 tgcttgtcgcctaacaaactccaccctagagttggt 33611176  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 67 - 151
Target Start/End: Original strand, 13015021 - 13015105
Alignment:
67 ggactagctagtaatgcggcttctcctacaagaatatgagcaacctcattggcttgtcgcctaanaaacttcactctagagttgg 151  Q
    |||||||||||||| | || ||||| | |||||  |||||||||||| |||||||||||||||| ||||| ||| | ||||||||    
13015021 ggactagctagtaacgtggattctcttgcaagagcatgagcaacctcgttggcttgtcgcctaacaaactacacccgagagttgg 13015105  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 51 - 149
Target Start/End: Original strand, 2175046 - 2175144
Alignment:
51 atgaaaataaatggtgggactagctagtaatgcggcttctcctacaagaatatgagcaacctcattggcttgtcgcctaanaaacttcactctagagtt 149  Q
    |||| ||||||||||||||||| ||| ||||| ||| |||||||| | || ||||||||||||||  ||||||| |  || ||||| ||| ||||||||    
2175046 atgataataaatggtgggactaactactaatgtggcctctcctacgaaaacatgagcaacctcatctgcttgtctctgaataaactccaccctagagtt 2175144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 17 - 149
Target Start/End: Complemental strand, 32480346 - 32480215
Alignment:
17 attaataataagagattcaataccattcgggcatatgaaaataaatggtgggactagctagtaatgcggcttctcctacaagaatatgagcaacctcatt 116  Q
    |||||||||||||| |||||||| ||| | | |||| ||||||||  | |||||||||||   | | ||| || | | ||||| ||||||||||| | ||    
32480346 attaataataagagtttcaatacaatt-gagtatattaaaataaactgcgggactagctaaagacgtggcctcccttgcaagagtatgagcaaccacgtt 32480248  T
117 ggcttgtcgcctaanaaacttcactctagagtt 149  Q
    |||||||||||||| ||||| ||| ||||||||    
32480247 ggcttgtcgcctaacaaactccaccctagagtt 32480215  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 66 - 152
Target Start/End: Original strand, 48100797 - 48100883
Alignment:
66 gggactagctagtaatgcggcttctcctacaagaatatgagcaacctcattggcttgtcgcctaanaaacttcactctagagttggt 152  Q
    ||||||| |||| || | || ||||||| |||| | |||||||||| |||| ||||||||||||  ||||| ||| |||||||||||    
48100797 gggactaactagaaacgtggattctcctgcaagcacatgagcaaccacatttgcttgtcgcctagcaaactccaccctagagttggt 48100883  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 73; Significance: 2e-33; HSPs: 10)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 17 - 152
Target Start/End: Complemental strand, 11553458 - 11553324
Alignment:
17 attaataataagagattcaataccattcgggcatatgaaaataaatggtgggactagctagtaatgcggcttctcctacaagaatatgagcaacctcatt 116  Q
    |||||||||||||| |||||||  ||||||| |||||||||||||||||||||||||||||||||| |||||||||| | |||| |||| ||||||||||    
11553458 attaataataagagtttcaatat-attcgggtatatgaaaataaatggtgggactagctagtaatgtggcttctcctgcgagaacatgatcaacctcatt 11553360  T
117 ggcttgtcgcctaanaaacttcactctagagttggt 152  Q
     |||||||||| |  ||||| ||| |||||||||||    
11553359 agcttgtcgccgagtaaactccaccctagagttggt 11553324  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 17 - 152
Target Start/End: Original strand, 11818452 - 11818586
Alignment:
17 attaataataagagattcaataccattcgggcatatgaaaataaatggtgggactagctagtaatgcggcttctcctacaagaatatgagcaacctcatt 116  Q
    |||||||||||||| |||||||  ||| ||| || |||||||||||   ||||||||||||||| | |||||||||| |||||| |||||||||||| ||    
11818452 attaataataagaggttcaatataatt-gggtatctgaaaataaataacgggactagctagtaacgtggcttctcctgcaagaacatgagcaacctcgtt 11818550  T
117 ggcttgtcgcctaanaaacttcactctagagttggt 152  Q
     ||||||||||||| ||||| ||| |||||||||||    
11818551 tgcttgtcgcctaacaaactccaccctagagttggt 11818586  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 66 - 150
Target Start/End: Complemental strand, 36641442 - 36641358
Alignment:
66 gggactagctagtaatgcggcttctcctacaagaatatgagcaacctcattggcttgtcgcctaanaaacttcactctagagttg 150  Q
    ||||||||||||||||| |||||||  | |||||  |||||||||||| |||||||||||||||| ||||| ||| | |||||||    
36641442 gggactagctagtaatgtggcttcttttgcaagagcatgagcaacctcgttggcttgtcgcctaacaaactccacccgagagttg 36641358  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 17 - 152
Target Start/End: Complemental strand, 14231154 - 14231020
Alignment:
17 attaataataagagattcaataccattcgggcatatgaaaataaatggtgggactagctagtaatgcggcttctcctacaagaatatgagcaacctcatt 116  Q
    ||||||||| | || |||||||| ||| ||| ||||||||||| ||   ||||||||| || |||| |||||| | | ||||| | ||||| ||| ||||    
14231154 attaataatcaaagtttcaatacaatt-gggtatatgaaaatagataacgggactagcgagaaatgtggcttcccttgcaagagtgtgagccaccacatt 14231056  T
117 ggcttgtcgcctaanaaacttcactctagagttggt 152  Q
     ||||||||||||| ||||| |||||||||||||||    
14231055 agcttgtcgcctaacaaactccactctagagttggt 14231020  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 84 - 149
Target Start/End: Complemental strand, 11502387 - 11502322
Alignment:
84 ggcttctcctacaagaatatgagcaacctcattggcttgtcgcctaanaaacttcactctagagtt 149  Q
    |||||||| | ||||| ||||||||||| | |||||||||||||||| ||||| ||| ||||||||    
11502387 ggcttctcttgcaagagtatgagcaaccacgttggcttgtcgcctaacaaactccaccctagagtt 11502322  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 21 - 149
Target Start/End: Complemental strand, 16206666 - 16206539
Alignment:
21 ataataagagattcaataccattcgggcatatgaaaataaatggtgggactagctagtaatgcggcttctcctacaagaatatgagcaacctcattggct 120  Q
    |||||||||| |||||||| ||| ||| |||| |||||||| || |||||||||||   | | ||| || | | |||||  |||||||||| | ||||||    
16206666 ataataagagtttcaatacaatt-gggtatattaaaataaacggcgggactagctaaagacgtggcctcccttgcaagagcatgagcaaccacgttggct 16206568  T
121 tgtcgcctaanaaacttcactctagagtt 149  Q
    |||||||||| ||||| ||| ||||||||    
16206567 tgtcgcctaacaaactccaccctagagtt 16206539  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 65 - 149
Target Start/End: Original strand, 27267944 - 27268028
Alignment:
65 tgggactagctagtaatgcggcttctcctacaagaatatgagcaacctcattggcttgtcgcctaanaaacttcactctagagtt 149  Q
    |||||||| ||||||| | |||||||| | ||||  ||||||||||||| || ||||||| ||||| ||||| ||| ||||||||    
27267944 tgggactaactagtaacgtggcttctcttgcaagtgtatgagcaacctcgttagcttgtcacctaacaaactccaccctagagtt 27268028  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 49 - 152
Target Start/End: Original strand, 10973588 - 10973691
Alignment:
49 atatgaaaataaatggtgggactagctagtaatgcggcttctcctacaagaatatgagcaacctcattggcttgtcgcctaanaaacttcactctagagt 148  Q
    |||||||||||||| ||||||| | | || |||| |||||| ||||| ||| | ||||| ||| |||| |||||||||| || ||||| ||| | |||||    
10973588 atatgaaaataaattgtgggacaaacgagaaatgtggcttcccctacgagagtgtgagccaccacattagcttgtcgccgaacaaactccacccgagagt 10973687  T
149 tggt 152  Q
    ||||    
10973688 tggt 10973691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 17 - 152
Target Start/End: Complemental strand, 33651008 - 33650874
Alignment:
17 attaataataagagattcaataccattcgggcatatgaaaataaatggtgggactagctagtaatgcggcttctcctacaagaatatgagcaacctcatt 116  Q
    ||||||||||||| ||||||||| ||| ||| || | ||||||||    |||||||||||| || | | ||||| || |||| | |||| ||||| ||||    
33651008 attaataataagatattcaatacgatt-gggtatgttaaaataaacaacgggactagctagaaacgtgacttcttctgcaagcacatgaacaaccgcatt 33650910  T
117 ggcttgtcgcctaanaaacttcactctagagttggt 152  Q
     |||||| ||||   |||||||||||||||||||||    
33650909 tgcttgttgcctggcaaacttcactctagagttggt 33650874  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 30 - 149
Target Start/End: Complemental strand, 44886413 - 44886295
Alignment:
30 gattcaataccattcgggcatatgaaaataaatggtgggactagctagtaatgcggcttctcctacaagaatatgagcaacctcattggcttgtcgccta 129  Q
    |||||||||| ||||||| |||| | ||||||| |||||| ||||||  || | |||||||| | ||||   |||||||||| | ||| |||||||||||    
44886413 gattcaatac-attcgggtatatcataataaatagtgggattagctaagaacgtggcttctcttgcaagtgcatgagcaaccgcgttgacttgtcgccta 44886315  T
130 anaaacttcactctagagtt 149  Q
    | ||||| ||| ||||||||    
44886314 acaaactccaccctagagtt 44886295  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 65; Significance: 1e-28; HSPs: 6)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 17 - 152
Target Start/End: Complemental strand, 16416732 - 16416598
Alignment:
17 attaataataagagattcaataccattcgggcatatgaaaataaatggtgggactagctagtaatgcggcttctcctacaagaatatgagcaacctcatt 116  Q
    |||||||||||||| |||||||| ||| ||| ||||||||||||||  || ||||||||||||||| | | |||||| |||||||| |||||||||||||    
16416732 attaataataagaggttcaatacaatt-gggtatatgaaaataaataatgagactagctagtaatgtgacatctcctgcaagaatacgagcaacctcatt 16416634  T
117 ggcttgtcgcctaanaaacttcactctagagttggt 152  Q
      |||||||||||| ||||| ||| |||||||||||    
16416633 tacttgtcgcctaacaaactacaccctagagttggt 16416598  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 17 - 240
Target Start/End: Original strand, 23508859 - 23509081
Alignment:
17 attaataataagagattcaataccattcgggcatatgaaaataaatggtgggactagctagtaatgcggcttctcctacaagaatatgagcaacctcatt 116  Q
    |||||||||||||| |||||||| || | || || ||||| ||||    |||||||||| |||||| |||||||||| |||||| |||||||||| ||||    
23508859 attaataataagaggttcaatacaat-caggtatgtgaaattaaacaacgggactagctcgtaatgtggcttctcctgcaagaacatgagcaaccccatt 23508957  T
117 ggcttgtcgcctaanaaacttcactctagagttggtnnnnnnntaactaactagagtacgacaggaagaaatnatgcacctaaattca-aagtagtcgtc 215  Q
     ||||||||||||| ||||| ||| ||||| |||||        |||||| |||||  ||||| || || || ||||||||||||||| |||| ||| ||    
23508958 tgcttgtcgcctaacaaactccaccctagaattggtaaagaaagaactaaatagagaccgacatgatgagataatgcacctaaattcagaagt-gtcatc 23509056  T
216 ttgagtagnatggaaggcatcncaa 240  Q
    | || ||| |||||||||||| |||    
23509057 tcgattagcatggaaggcatcacaa 23509081  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 21 - 149
Target Start/End: Original strand, 34355757 - 34355884
Alignment:
21 ataataagagattcaataccattcgggcatatgaaaataaatggtgggactagctagtaatgcggcttctcctacaagaatatgagcaacctcattggct 120  Q
    |||||||||| |||||||| ||| ||| |||| ||||||||  | |||||||||||||||   || ||||| | |||||  |||||||||||| ||||||    
34355757 ataataagagtttcaatacaatt-gggtatatcaaaataaacagcgggactagctagtaacatggtttctcttgcaagagcatgagcaacctcgttggct 34355855  T
121 tgtcgcctaanaaacttcactctagagtt 149  Q
    | |||| ||| ||||||||| ||||||||    
34355856 tttcgcataacaaacttcaccctagagtt 34355884  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 17 - 152
Target Start/End: Original strand, 30140947 - 30141081
Alignment:
17 attaataataagagattcaataccattcgggcatatgaaaataaatggtgggactagctagtaatgcggcttctcctacaagaatatgagcaacctcatt 116  Q
    ||||||||| | || |||||||| ||| ||| ||||||||||| || | ||||||||| || |||| ||||||   | ||||| | ||| | ||| ||||    
30140947 attaataatcaaagtttcaatacaatt-gggtatatgaaaatagatagcgggactagcgagaaatgtggcttcctttgcaagagtgtgatccaccacatt 30141045  T
117 ggcttgtcgcctaanaaacttcactctagagttggt 152  Q
     ||||||||||||| ||||| ||| |||||||||||    
30141046 agcttgtcgcctaacaaactccaccctagagttggt 30141081  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 102 - 149
Target Start/End: Original strand, 1493335 - 1493382
Alignment:
102 atgagcaacctcattggcttgtcgcctaanaaacttcactctagagtt 149  Q
    |||||||||| | |||||||||||||||| ||||| ||| ||||||||    
1493335 atgagcaaccgcgttggcttgtcgcctaacaaactccaccctagagtt 1493382  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 102 - 149
Target Start/End: Complemental strand, 9959274 - 9959227
Alignment:
102 atgagcaacctcattggcttgtcgcctaanaaacttcactctagagtt 149  Q
    |||||||||| | |||||||||||||||| ||||| ||| ||||||||    
9959274 atgagcaaccgcgttggcttgtcgcctaacaaactccaccctagagtt 9959227  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 61; Significance: 3e-26; HSPs: 11)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 17 - 152
Target Start/End: Complemental strand, 13686139 - 13686005
Alignment:
17 attaataataagagattcaataccattcgggcatatgaaaataaatggtgggactagctagtaatgcggcttctcctacaagaatatgagcaacctcatt 116  Q
    ||||||||||||||||||||||| || |||| |||||||||||||   |||||||||||||||| | | |||||| | |||||| |||||||||| | ||    
13686139 attaataataagagattcaatacaat-cgggtatatgaaaataaacaatgggactagctagtaacgtgacttctcttgcaagaacatgagcaaccccgtt 13686041  T
117 ggcttgtcgcctaanaaacttcactctagagttggt 152  Q
     ||||||||||||| ||||| ||| |||||||||||    
13686040 tgcttgtcgcctaacaaactccaccctagagttggt 13686005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 49 - 152
Target Start/End: Original strand, 54027742 - 54027845
Alignment:
49 atatgaaaataaatggtgggactagctagtaatgcggcttctcctacaagaatatgagcaacctcattggcttgtcgcctaanaaacttcactctagagt 148  Q
    |||||||||||||| | |||| |||| || |||| |||||| ||||||||| | ||||| ||| |||| ||||||||||||| ||||| ||| |||||||    
54027742 atatgaaaataaatagcgggagtagcgagaaatgtggcttcccctacaagagtgtgagccaccacattagcttgtcgcctaaaaaactccaccctagagt 54027841  T
149 tggt 152  Q
    ||||    
54027842 tggt 54027845  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 17 - 93
Target Start/End: Complemental strand, 4462703 - 4462628
Alignment:
17 attaataataagagattcaataccattcgggcatatgaaaataaatggtgggactagctagtaatgcggcttctcct 93  Q
    ||||||||||| || |||||||| |||| |  |||||||||||||| |||||||||| |||||||| ||||||||||    
4462703 attaataataaaagtttcaatac-attcagatatatgaaaataaattgtgggactagttagtaatgtggcttctcct 4462628  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 17 - 151
Target Start/End: Original strand, 16582347 - 16582480
Alignment:
17 attaataataagagattcaataccattcgggcatatgaaaataaatggtgggactagctagtaatgcggcttctcctacaagaatatgagcaacctcatt 116  Q
    ||||||||||| || |||||||| | | ||| || | |||||||| |||||||||||||||||| | | |||||| | |||||  ||||||| |||| ||    
16582347 attaataataatagtttcaatacaact-gggtatttcaaaataaacggtgggactagctagtaacgtgacttctcttgcaagagcatgagcagcctcgtt 16582445  T
117 ggcttgtcgcctaanaaacttcactctagagttgg 151  Q
    |||||||||||  | ||||| ||| ||| ||||||    
16582446 ggcttgtcgcccgacaaactccaccctaaagttgg 16582480  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 21 - 149
Target Start/End: Complemental strand, 55227739 - 55227612
Alignment:
21 ataataagagattcaataccattcgggcatatgaaaataaatggtgggactagctagtaatgcggcttctcctacaagaatatgagcaacctcattggct 120  Q
    |||||||||| |||||||| ||| ||| |||| |||||||| || |||||||||||   ||| ||| || | | |||||  |||||||||| | |||| |    
55227739 ataataagagtttcaatacaatt-gggtatattaaaataaacggcgggactagctaaagatgtggcctcccttgcaagagcatgagcaaccacgttggtt 55227641  T
121 tgtcgcctaanaaacttcactctagagtt 149  Q
    |||||||||| ||||| ||| ||||||||    
55227640 tgtcgcctaacaaactccaccctagagtt 55227612  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 18 - 152
Target Start/End: Original strand, 37061059 - 37061192
Alignment:
18 ttaataataagagattcaataccattcgggcatatgaaaataaatggtgggactagctagtaatgcggcttctcctacaagaatatgagcaacctcattg 117  Q
    |||||||||||||||||||||| || |||| || | ||||||||    |||||||||||| ||   |||||||| | |||| | |||||||||| ||||     
37061059 ttaataataagagattcaatacaat-cgggtatgttaaaataaacaacgggactagctagaaacatggcttctcttgcaagcacatgagcaaccacattt 37061157  T
118 gcttgtcgcctaanaaacttcactctagagttggt 152  Q
    | ||||| ||||  ||||| ||| |||||||||||    
37061158 gtttgtcacctagcaaactccaccctagagttggt 37061192  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 21 - 149
Target Start/End: Complemental strand, 30859490 - 30859363
Alignment:
21 ataataagagattcaataccattcgggcatatgaaaataaatggtgggactagctagtaatgcggcttctcctacaagaatatgagcaacctcattggct 120  Q
    |||||||||| |||||||| ||| ||| |||| |||||||| || |||||||| ||   | | ||| || | | |||||  |||||||||| | ||||||    
30859490 ataataagagtttcaatacaatt-gggtatattaaaataaacggcgggactagttaaagacgtggcctcccttgcaagagcatgagcaaccacgttggct 30859392  T
121 tgtcgcctaanaaacttcactctagagtt 149  Q
    |||||||||| ||||| ||| ||||||||    
30859391 tgtcgcctaacaaactccaccctagagtt 30859363  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 74 - 149
Target Start/End: Original strand, 16431420 - 16431495
Alignment:
74 ctagtaatgcggcttctcctacaagaatatgagcaacctcattggcttgtcgcctaanaaacttcactctagagtt 149  Q
    ||||||| | |||||||| | |||||  |||| ||||||| |||| ||||||||||| ||||| ||| ||||||||    
16431420 ctagtaacgtggcttctcttgcaagagcatgaacaacctcgttggtttgtcgcctaacaaactccaccctagagtt 16431495  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 49 - 152
Target Start/End: Original strand, 27066580 - 27066683
Alignment:
49 atatgaaaataaatggtgggactagctagtaatgcggcttctcctacaagaatatgagcaacctcattggcttgtcgcctaanaaacttcactctagagt 148  Q
    ||||||||||| || | ||||||||| || |||| ||||||   | ||||| | ||| | ||| |||| ||||||||||||| ||||| ||| |||||||    
27066580 atatgaaaatagatagcgggactagcgagaaatgtggcttcctttgcaagagtgtgacccaccacattagcttgtcgcctaacaaactccaccctagagt 27066679  T
149 tggt 152  Q
    ||||    
27066680 tggt 27066683  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 49 - 152
Target Start/End: Original strand, 27066774 - 27066877
Alignment:
49 atatgaaaataaatggtgggactagctagtaatgcggcttctcctacaagaatatgagcaacctcattggcttgtcgcctaanaaacttcactctagagt 148  Q
    ||||||||||| || | ||||||||| || |||| ||||||   | ||||| | ||| | ||| |||| ||||||||||||| ||||| ||| |||||||    
27066774 atatgaaaatagatagcgggactagcgagaaatgtggcttcctttgcaagagtgtgacccaccacattagcttgtcgcctaacaaactccaccctagagt 27066873  T
149 tggt 152  Q
    ||||    
27066874 tggt 27066877  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 49 - 152
Target Start/End: Original strand, 27087487 - 27087590
Alignment:
49 atatgaaaataaatggtgggactagctagtaatgcggcttctcctacaagaatatgagcaacctcattggcttgtcgcctaanaaacttcactctagagt 148  Q
    ||||||||||| || | ||||||||| || |||| ||||||   | ||||| | ||| | ||| |||| ||||||||||||| ||||| ||| |||||||    
27087487 atatgaaaatagatagcgggactagcgagaaatgtggcttcctttgcaagagtgtgacccaccacattagcttgtcgcctaacaaactccaccctagagt 27087586  T
149 tggt 152  Q
    ||||    
27087587 tggt 27087590  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 8)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 17 - 152
Target Start/End: Complemental strand, 49499541 - 49499407
Alignment:
17 attaataataagagattcaataccattcgggcatatgaaaataaatggtgggactagctagtaatgcggcttctcctacaagaatatgagcaacctcatt 116  Q
    ||||||||||||||||||||||| || |||  || | |||||||||   | |||||||||| || | |||||||| | |||||| ||||||| || ||||    
49499541 attaataataagagattcaatacaat-cggatatgttaaaataaataacgagactagctagaaacgtggcttctcttgcaagaacatgagcagccacatt 49499443  T
117 ggcttgtcgcctaanaaacttcactctagagttggt 152  Q
     ||||||||||||  ||||| ||| |||||||||||    
49499442 tgcttgtcgcctagcaaactccaccctagagttggt 49499407  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 17 - 149
Target Start/End: Original strand, 19602928 - 19603059
Alignment:
17 attaataataagagattcaataccattcgggcatatgaaaataaatggtgggactagctagtaatgcggcttctcctacaagaatatgagcaacctcatt 116  Q
    ||||||||||||||||| ||||| || |||  ||||  ||||||||| ||||||||||||  || |  ||||||| | ||||| ||||||||||| | ||    
19602928 attaataataagagattaaatacaat-cggatatatcgaaataaatgctgggactagctaaaaacgtcgcttctcttgcaagagtatgagcaaccgcgtt 19603026  T
117 ggcttgtcgcctaanaaacttcactctagagtt 149  Q
    | |||||| ||||| ||||| ||| ||||||||    
19603027 gccttgtcacctaacaaactccaccctagagtt 19603059  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 21 - 149
Target Start/End: Original strand, 6006048 - 6006175
Alignment:
21 ataataagagattcaataccattcgggcatatgaaaataaatggtgggactagctagtaatgcggcttctcctacaagaatatgagcaacctcattggct 120  Q
    |||||||||| |||||||| ||| ||| |||| |||||||| || |||||||||||   | | |||||| | | |||||  ||||| |||| | ||||||    
6006048 ataataagagtttcaatacaatt-gggtatattaaaataaacggcgggactagctaaagacgtggcttcccttgcaagagcatgagaaaccacgttggct 6006146  T
121 tgtcgcctaanaaacttcactctagagtt 149  Q
    |||||||||| ||||| ||| ||||||||    
6006147 tgtcgcctaacaaactccaccctagagtt 6006175  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 17 - 110
Target Start/End: Complemental strand, 36144857 - 36144765
Alignment:
17 attaataataagagattcaataccattcgggcatatgaaaataaatggtgggactagctagtaatgcggcttctcctacaagaatatgagcaac 110  Q
    |||||||| ||||| |||||||| || |||| |||||||||||||| |||||||||| ||||||   ||| |||| | |||||| |||||||||    
36144857 attaataacaagaggttcaatacaat-cgggtatatgaaaataaatagtgggactagttagtaacatggcctctcgtgcaagaacatgagcaac 36144765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 66 - 151
Target Start/End: Original strand, 16739487 - 16739572
Alignment:
66 gggactagctagtaatgcggcttctcctacaagaatatgagcaacctcattggcttgtcgcctaanaaacttcactctagagttgg 151  Q
    ||||||||||||||| | |||||||| | |||||  || ||||| ||| |||| ||||||||||| ||||| ||| | ||||||||    
16739487 gggactagctagtaacgtggcttctcttgcaagagcattagcaatctcgttggtttgtcgcctaacaaactccacccgagagttgg 16739572  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 20 - 152
Target Start/End: Complemental strand, 18357236 - 18357104
Alignment:
20 aataataagagattcaataccattcgggcatatgaaaataaatggtgggactagctagtaatgcggcttctcctacaagaatatgagcaacctcatt-gg 118  Q
    |||||||||||||||||||  ||||||| |||| ||||||||    || | |||||||||| | |||||||||| |||||  |||||||| | | || ||    
18357236 aataataagagattcaatat-attcgggtatatcaaaataaacaacggaattagctagtaacgtggcttctcctgcaagagcatgagcaatcccgtttgg 18357138  T
119 cttgtcgcctaanaaacttcactctagagttggt 152  Q
    ||| || ||||| ||||| ||| |||||||||||    
18357137 cttatcacctaacaaactccaccctagagttggt 18357104  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 102 - 149
Target Start/End: Complemental strand, 31228285 - 31228238
Alignment:
102 atgagcaacctcattggcttgtcgcctaanaaacttcactctagagtt 149  Q
    |||||||||| | |||||||||||||||| ||||| ||| ||||||||    
31228285 atgagcaaccacgttggcttgtcgcctaacaaactccaccctagagtt 31228238  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 102 - 149
Target Start/End: Original strand, 31661066 - 31661113
Alignment:
102 atgagcaacctcattggcttgtcgcctaanaaacttcactctagagtt 149  Q
    |||||||||| | |||||||||||||||| ||||| ||| ||||||||    
31661066 atgagcaaccgcgttggcttgtcgcctaacaaactccaccctagagtt 31661113  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0643 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: scaffold0643
Description:

Target: scaffold0643; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 17 - 152
Target Start/End: Complemental strand, 1179 - 1045
Alignment:
17 attaataataagagattcaataccattcgggcatatgaaaataaatggtgggactagctagtaatgcggcttctcctacaagaatatgagcaacctcatt 116  Q
    ||||||||| | | ||||||||| ||| ||| |||||||||||||| | ||||||||| || |||| |||||| | |  |||| | ||||| ||| ||||    
1179 attaataatcaaacattcaatacaatt-gggtatatgaaaataaatagcgggactagcgagaaatgtggcttcccttgtaagattgtgagccaccacatt 1081  T
117 ggcttgtcgcctaanaaacttcactctagagttggt 152  Q
     | ||||||||||| ||||| ||| |||||||||||    
1080 agtttgtcgcctaacaaactccaccctagagttggt 1045  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0789 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0789
Description:

Target: scaffold0789; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 102 - 149
Target Start/End: Original strand, 4309 - 4356
Alignment:
102 atgagcaacctcattggcttgtcgcctaanaaacttcactctagagtt 149  Q
    |||||||||||| |||||||||||||||| ||||| ||| ||||||||    
4309 atgagcaacctctttggcttgtcgcctaacaaactccaccctagagtt 4356  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0040 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0040
Description:

Target: scaffold0040; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 102 - 149
Target Start/End: Original strand, 62581 - 62628
Alignment:
102 atgagcaacctcattggcttgtcgcctaanaaacttcactctagagtt 149  Q
    |||||||||| | |||||||||||||||| ||||| ||| ||||||||    
62581 atgagcaaccacgttggcttgtcgcctaacaaactccaccctagagtt 62628  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0011 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0011
Description:

Target: scaffold0011; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 102 - 149
Target Start/End: Original strand, 191097 - 191144
Alignment:
102 atgagcaacctcattggcttgtcgcctaanaaacttcactctagagtt 149  Q
    |||||||||| | |||||||||||||||| ||||| ||| ||||||||    
191097 atgagcaaccgcgttggcttgtcgcctaacaaactccaccctagagtt 191144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 313520 times since January 2019
Visitors: 446