View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5_17_12 (Length: 128)

Name: J5_17_12
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5_17_12
J5_17_12
[»] chr4 (2 HSPs)
chr4 (1-71)||(45173873-45173943)
chr4 (66-128)||(45173815-45173877)


Alignment Details
Target: chr4 (Bit Score: 71; Significance: 1e-32; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 71; E-Value: 1e-32
Query Start/End: Original strand, 1 - 71
Target Start/End: Original strand, 45173873 - 45173943
Alignment:
1 gaacatagctaactaacaattggtacagttagacttagagtgtgctctgctatcttccagtccatattaat 71  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45173873 gaacatagctaactaacaattggtacagttagacttagagtgtgctctgctatcttccagtccatattaat 45173943  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 42; E-Value: 0.000000000000003
Query Start/End: Original strand, 66 - 128
Target Start/End: Original strand, 45173815 - 45173877
Alignment:
66 attaatttgacatcaagagattgtgtaaatgnnnnnnntgtgagtaagaagattagaagaaca 128  Q
    |||||||||||||||||||||||||||||||       |||||||||||||||||||||||||    
45173815 attaatttgacatcaagagattgtgtaaatgaaaaaaatgtgagtaagaagattagaagaaca 45173877  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 362132 times since January 2019
Visitors: 488