View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5_17_87 (Length: 116)

Name: J5_17_87
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5_17_87
J5_17_87
[»] chr4 (2 HSPs)
chr4 (25-116)||(52068523-52068614)
chr4 (1-30)||(52068610-52068639)


Alignment Details
Target: chr4 (Bit Score: 86; Significance: 1e-41; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 86; E-Value: 1e-41
Query Start/End: Original strand, 25 - 116
Target Start/End: Original strand, 52068523 - 52068614
Alignment:
25 tgaattnccatcaacttctactgacaccaaatattttntagaatatactttggggatgatagattgatacgtatatctgtaaaagtgaacat 116  Q
    |||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52068523 tgaattcccatcaacttctactgacaccaaatattttttagaatatactttggggatgatagattgatacgtatatctgtaaaagtgaacat 52068614  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000004
Query Start/End: Original strand, 1 - 30
Target Start/End: Original strand, 52068610 - 52068639
Alignment:
1 aacatgatcttattattggtatgatgaatt 30  Q
    ||||||||||||||||||||||||||||||    
52068610 aacatgatcttattattggtatgatgaatt 52068639  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 309048 times since January 2019
Visitors: 444