View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5_17_95 (Length: 277)

Name: J5_17_95
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5_17_95
J5_17_95
[»] chr1 (2 HSPs)
chr1 (1-238)||(51054460-51054697)
chr1 (249-277)||(51054436-51054464)
[»] chr3 (1 HSPs)
chr3 (13-237)||(34619913-34620151)


Alignment Details
Target: chr1 (Bit Score: 238; Significance: 1e-132; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 51054460 - 51054697
Alignment:
1 ctcaaggtcattgtggtgattatagttgaataatatgctaaagtgaggcgttgaataattgaattaaccttagagcatttgcctctagagtaaatttatg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51054460 ctcaaggtcattgtggtgattatagttgaataatatgctaaagtgaggcgttgaataattgaattaaccttagagcatttgcctctagagtaaatttatg 51054559  T
101 gcccccctgccttagggacatgatagaactgtgttaaagatagattctcaccgtcattggcaataatgaagcattaggccaaaaacctcttaaacatata 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51054560 gcccccctgccttagggacatgatagaactgtgttaaagatagattctcaccgtcattggcaataatgaagcattaggccaaaaacctcttaaacatata 51054659  T
201 taattacaagcacaagtcagaaaggcaattaacaatgt 238  Q
    ||||||||||||||||||||||||||||||||||||||    
51054660 taattacaagcacaagtcagaaaggcaattaacaatgt 51054697  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 249 - 277
Target Start/End: Original strand, 51054436 - 51054464
Alignment:
249 tgcaattgacaccaaatcaaagaactcaa 277  Q
    |||||||||||||||||||||||||||||    
51054436 tgcaattgacaccaaatcaaagaactcaa 51054464  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 74; Significance: 5e-34; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 13 - 237
Target Start/End: Complemental strand, 34620151 - 34619913
Alignment:
13 gtggtgattatagttgaataatatgctaaagtgaggcgttgaataattgaattaaccttagagcatttgcctctagagtaaatttatggcccccctgcct 112  Q
    ||||||||||||||||||||| ||| ||||||||||||||||||        |||||||||||||||||| |||||||||||| ||||| ||| |  |||    
34620151 gtggtgattatagttgaataaaatgttaaagtgaggcgttgaat--------taaccttagagcatttgcttctagagtaaatatatggaccctc--cct 34620062  T
113 tagggacatgatagaactg------------------tgttaaagatagattctcaccgtcattggcaataatgaagcattaggcca----aaaacctct 190  Q
    |||||||||||||||| ||                  ||||||||||||||||||||||||||||| ||||||||||||||||||||    |||||||||    
34620061 tagggacatgatagaaatgaaagacaatgatgaaatgtgttaaagatagattctcaccgtcattgggaataatgaagcattaggccaaattaaaacctct 34619962  T
191 taaaca--tatataattacaagcacaagtcagaaaggcaattaacaatg 237  Q
    ||||||  || ||||||||||||  |||||||||||| |||||||||||    
34619961 taaacatgtacataattacaagcctaagtcagaaaggtaattaacaatg 34619913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 175849 times since January 2019
Visitors: 1577