View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5_2_11 (Length: 200)

Name: J5_2_11
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5_2_11
J5_2_11
[»] chr2 (2 HSPs)
chr2 (42-200)||(709538-709696)
chr2 (1-47)||(709496-709542)
[»] chr1 (2 HSPs)
chr1 (91-176)||(19808924-19809008)
chr1 (62-143)||(28303265-28303347)


Alignment Details
Target: chr2 (Bit Score: 153; Significance: 3e-81; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 42 - 200
Target Start/End: Complemental strand, 709696 - 709538
Alignment:
42 attaatcacacttttaaanggttactaaccaaacttttcaagtgtatgcttgaacacaagttatggttaataatatcatgtatatttgaaaacctaaaaa 141  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
709696 attaatcacacttttaaatggttactaaccaaacttttcaagtgtatgcttgaacacaagttatggttaataatatcatgtatatttgaaaacctaaaaa 709597  T
142 ttcatgtataatttgaacacnatttggatggttattaacgaatatatgtatgttagaac 200  Q
    |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
709596 ttcatgtataatttgaacacaatttggatggttattaacgaatatatgtatgttagaac 709538  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 709542 - 709496
Alignment:
1 agaacatctaaataatgtggttaatgacgttcaaaatcgtgattaat 47  Q
    |||||||||||||||||||||||||||||||||||||||||||||||    
709542 agaacatctaaataatgtggttaatgacgttcaaaatcgtgattaat 709496  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 32; Significance: 0.000000004; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 91 - 176
Target Start/End: Complemental strand, 19809008 - 19808924
Alignment:
91 ttgaacacaagttatggttaata-atatcatgtatatttgaaaacctaaaaattcatgtataatttgaacacnatttggatggttat 176  Q
    ||||||| ||||| ||||||||| || |||||||||||||||||||| | || |||||||| |||||||||  ||||| ||||||||    
19809008 ttgaacaaaagttgtggttaatacatttcatgtatatttgaaaacctcagaa-tcatgtat-atttgaacatgatttgaatggttat 19808924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 62 - 143
Target Start/End: Complemental strand, 28303347 - 28303265
Alignment:
62 gttactaaccaaacttttcaagtgtatgcttgaacacaagttatggttaata-atatcatgtatatttgaaaacctaaaaatt 143  Q
    |||| |||||| | || ||| ||||||  |||||||||| || ||||||||| ||||||||||||||||||||| | ||||||    
28303347 gttattaaccacaattatcatgtgtatatttgaacacaaattgtggttaatagatatcatgtatatttgaaaacttgaaaatt 28303265  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 315724 times since January 2019
Visitors: 447