View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5_2_13 (Length: 590)

Name: J5_2_13
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5_2_13
J5_2_13
[»] chr3 (14 HSPs)
chr3 (1-501)||(23216710-23217208)
chr3 (181-369)||(30765876-30766064)
chr3 (21-109)||(30765754-30765839)
chr3 (293-397)||(50831133-50831238)
chr3 (293-397)||(50844615-50844720)
chr3 (407-463)||(29808088-29808143)
chr3 (415-461)||(1659748-1659794)
chr3 (427-462)||(3858079-3858114)
chr3 (415-458)||(26897308-26897351)
chr3 (415-462)||(42875567-42875614)
chr3 (425-460)||(52689599-52689634)
chr3 (429-463)||(5104438-5104472)
chr3 (429-459)||(6419369-6419399)
chr3 (427-463)||(26042031-26042067)
[»] chr6 (5 HSPs)
chr6 (10-413)||(11074861-11075260)
chr6 (427-461)||(4333646-4333680)
chr6 (427-461)||(4333850-4333884)
chr6 (431-459)||(10972956-10972984)
chr6 (427-459)||(32923112-32923144)
[»] chr7 (13 HSPs)
chr7 (1-408)||(33865601-33865982)
chr7 (132-369)||(5790347-5790584)
chr7 (418-460)||(2455650-2455692)
chr7 (416-458)||(7844583-7844625)
chr7 (416-458)||(7845953-7845995)
chr7 (429-461)||(2619716-2619748)
chr7 (431-463)||(21859190-21859222)
chr7 (427-463)||(45885149-45885185)
chr7 (416-463)||(23406286-23406333)
chr7 (416-463)||(30603817-30603864)
chr7 (416-463)||(41349668-41349715)
chr7 (431-463)||(778526-778558)
chr7 (415-463)||(38032092-38032140)
[»] scaffold0524 (1 HSPs)
scaffold0524 (141-404)||(5140-5405)
[»] chr4 (12 HSPs)
chr4 (145-281)||(7134942-7135078)
chr4 (322-399)||(34703780-34703858)
chr4 (46-101)||(7135287-7135342)
chr4 (170-227)||(42499085-42499142)
chr4 (427-459)||(221245-221277)
chr4 (427-463)||(1143144-1143180)
chr4 (427-463)||(34442246-34442282)
chr4 (431-462)||(27871809-27871840)
chr4 (429-458)||(42432764-42432793)
chr4 (430-479)||(46394820-46394868)
chr4 (431-463)||(49408420-49408452)
chr4 (429-457)||(49411165-49411193)
[»] chr1 (6 HSPs)
chr1 (322-399)||(28549343-28549421)
chr1 (322-399)||(41866997-41867075)
chr1 (430-462)||(12417039-12417071)
chr1 (416-463)||(34288401-34288448)
chr1 (425-463)||(17586152-17586190)
chr1 (430-463)||(16543704-16543737)
[»] chr2 (8 HSPs)
chr2 (46-101)||(17831232-17831287)
chr2 (141-204)||(17831138-17831201)
chr2 (415-463)||(25920904-25920952)
chr2 (427-463)||(12698733-12698769)
chr2 (430-460)||(4622521-4622551)
chr2 (430-463)||(15676179-15676212)
chr2 (430-463)||(17841551-17841584)
chr2 (435-463)||(30953925-30953953)
[»] scaffold0057 (1 HSPs)
scaffold0057 (425-463)||(49965-50003)
[»] chr5 (5 HSPs)
chr5 (418-463)||(1864603-1864648)
chr5 (339-404)||(30441298-30441364)
chr5 (430-463)||(16855861-16855894)
chr5 (415-458)||(35796880-35796923)
chr5 (427-459)||(1945084-1945116)
[»] chr8 (5 HSPs)
chr8 (315-369)||(1605287-1605341)
chr8 (415-463)||(16027741-16027789)
chr8 (418-458)||(23399182-23399222)
chr8 (429-463)||(5200184-5200218)
chr8 (427-460)||(33359423-33359456)


Alignment Details
Target: chr3 (Bit Score: 425; Significance: 0; HSPs: 14)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 425; E-Value: 0
Query Start/End: Original strand, 1 - 501
Target Start/End: Original strand, 23216710 - 23217208
Alignment:
1 cttgtgatatcgtcacttggttttttagaagggtaactggagtgagagagagaagagggacggaaaatggaagatgaatttctcatatcagagaaaaatg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
23216710 cttgtgatatcgtcacttggttttttagaagggtaactggagtgagagagagaagagggactgaaaatggaagatgaatttctcatatcagagaaaaatg 23216809  T
101 ggcgtgagatgatagnnnnnnnnnnnnnnnnacaaaaggcaaggaaatagttttgttagggatggttcagatgcctttggattgagaagagtgggtaaga 200  Q
    |||||||||||||||                |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
23216810 ggcgtgagatgataggagagagagagagagaacaaaaggcaaggaaatagttttgttagggatggttcagatgcctttggattgagaagagtgggtaaga 23216909  T
201 ttgaagccaaattttgagccatgtgcatgcctcggaaagaagcaagcattgaatgtttgatggaacaccaatgtttgatggataaaagcgaagggatttg 300  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||    
23216910 ttgaagccaaattttgagccatgtgcatgcctcggaaagaagcaagcattgaatgtttgatggaataccaatgtttgatggataaaagtgaagggatttg 23217009  T
301 aaatttgaattgtacattaagtgcagttaaagcaaagttttcccgctctaaatcaaggattagggtttttaggtcttctgtgcattgtacattaggattg 400  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
23217010 aaatttgaattgtacattaagtgcagttaaagcaaagttttcccgctctaaatcaaggattagggtttttaggtcttctgtgcattgtacattaggattg 23217109  T
401 gatataaagataagatatatataaacaaggatattttagtaatttacttaatttattatcggggtatggatttccgtagacacgggntatcatcgaatcc 500  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||    
23217110 gatataaagataagatatatataaacaaggatattttagtaatttacttaatttattatc-gggtatggatttccgtagacacggg-tatcatcgaatcc 23217207  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 101; E-Value: 9e-50
Query Start/End: Original strand, 181 - 369
Target Start/End: Original strand, 30765876 - 30766064
Alignment:
181 attgagaagagtgggtaagattgaagccaaattttgagccatgtgcatgcctcggaaagaagcaagcattgaatgtttgatggaacaccaatgtttgatg 280  Q
    ||||| |||||||||||| ||||||| ||| ||||||||||||||||||||||  || ||||| ||||||||||||||||||||| ||||||||||||||    
30765876 attgaaaagagtgggtaacattgaagtcaatttttgagccatgtgcatgcctcaaaatgaagcgagcattgaatgtttgatggaataccaatgtttgatg 30765975  T
281 gataaaagcgaagggatttgaaatttgaattgtacattaagtgcagttaaagcaaagttttcccgctctaaatcaaggattagggtttt 369  Q
    | ||| || |||| ||||||||||| ||||| ||||| || || |||||| ||||| ||||||||||||||||||  ||||||||||||    
30765976 ggtaacagtgaagagatttgaaattcgaattttacatcaaatgtagttaaggcaaaattttcccgctctaaatcatagattagggtttt 30766064  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 21 - 109
Target Start/End: Original strand, 30765754 - 30765839
Alignment:
21 ttttttagaagggtaactggagtgagagagagaagagggacggaaaatggaagatgaatttctcatatcagagaaaaatgggcgtgaga 109  Q
    |||||||| |||| |||||||||||||||||  |||||||| |||| |||||||||| ||||||  |||||||||||||||||||||||    
30765754 ttttttagcagggaaactggagtgagagaga--agagggactgaaa-tggaagatgactttctctcatcagagaaaaatgggcgtgaga 30765839  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 293 - 397
Target Start/End: Original strand, 50831133 - 50831238
Alignment:
293 gggatttgaaatttgaattgtacattaagtgcagttaaagcaaagttttcccgctctaaatcaaggattaggg-tttttaggtcttctgtgcattgtaca 391  Q
    |||||||||||||||||||  ||||||| || ||||||||||||  ||||| | || |||||||||||||||| |||||| || || |||| ||||||||    
50831133 gggatttgaaatttgaatttgacattaaatgtagttaaagcaaaagtttccggttcaaaatcaaggattagggttttttaagtgttgtgtgtattgtaca 50831232  T
392 ttagga 397  Q
    ||||||    
50831233 ttagga 50831238  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 293 - 397
Target Start/End: Complemental strand, 50844720 - 50844615
Alignment:
293 gggatttgaaatttgaattgtacattaagtgcagttaaagcaaagttttcccgctctaaatcaaggattagggt-ttttaggtcttctgtgcattgtaca 391  Q
    |||||||||||||||||||  ||||||| || ||||||||||||  ||||| | || ||||||||||||||||| ||||| || || |||| ||||||||    
50844720 gggatttgaaatttgaatttgacattaaatgtagttaaagcaaaagtttccggttcaaaatcaaggattagggttttttaagtgttgtgtgtattgtaca 50844621  T
392 ttagga 397  Q
    ||||||    
50844620 ttagga 50844615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 407 - 463
Target Start/End: Complemental strand, 29808143 - 29808088
Alignment:
407 aagataagatatatataaacaaggatattttagtaatttacttaatttattatcggg 463  Q
    ||||||||||| | ||| |||||||||||||||||||||||||||||||| ||||||    
29808143 aagataagata-agatatacaaggatattttagtaatttacttaatttatcatcggg 29808088  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 415 - 461
Target Start/End: Original strand, 1659748 - 1659794
Alignment:
415 atatatataaacaaggatattttagtaatttacttaatttattatcg 461  Q
    ||||||||| | ||||||||||||| |||||||||||||||||||||    
1659748 atatatatatataaggatattttagcaatttacttaatttattatcg 1659794  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 427 - 462
Target Start/End: Complemental strand, 3858114 - 3858079
Alignment:
427 aaggatattttagtaatttacttaatttattatcgg 462  Q
    |||||||||||| |||||||||||||||||||||||    
3858114 aaggatattttaataatttacttaatttattatcgg 3858079  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 415 - 458
Target Start/End: Complemental strand, 26897351 - 26897308
Alignment:
415 atatatataaacaaggatattttagtaatttacttaatttatta 458  Q
    ||||||||| ||| | ||||||||||||||||||||||||||||    
26897351 atatatatacacatgaatattttagtaatttacttaatttatta 26897308  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 415 - 462
Target Start/End: Complemental strand, 42875614 - 42875567
Alignment:
415 atatatataaacaaggatattttagtaatttacttaatttattatcgg 462  Q
    ||||||||| | || ||||||| |||||||||||||||||||||||||    
42875614 atatatatatataaagatatttaagtaatttacttaatttattatcgg 42875567  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 425 - 460
Target Start/End: Original strand, 52689599 - 52689634
Alignment:
425 acaaggatattttagtaatttacttaatttattatc 460  Q
    |||| |||||||||||||||||||||||||||||||    
52689599 acaaagatattttagtaatttacttaatttattatc 52689634  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 429 - 463
Target Start/End: Original strand, 5104438 - 5104472
Alignment:
429 ggatattttagtaatttacttaatttattatcggg 463  Q
    |||||||||||||||||||||||||||||| ||||    
5104438 ggatattttagtaatttacttaatttattaacggg 5104472  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 429 - 459
Target Start/End: Original strand, 6419369 - 6419399
Alignment:
429 ggatattttagtaatttacttaatttattat 459  Q
    |||||||||||||||||||||||||||||||    
6419369 ggatattttagtaatttacttaatttattat 6419399  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 427 - 463
Target Start/End: Original strand, 26042031 - 26042067
Alignment:
427 aaggatattttagtaatttacttaatttattatcggg 463  Q
    ||||||||||||||| |||| ||||||||||||||||    
26042031 aaggatattttagtagtttagttaatttattatcggg 26042067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 300; Significance: 1e-168; HSPs: 5)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 300; E-Value: 1e-168
Query Start/End: Original strand, 10 - 413
Target Start/End: Complemental strand, 11075260 - 11074861
Alignment:
10 tcgtcacttggttttttagaagggtaactggagtgagagagagaagagggacggaaaatggaagatgaatttctcatatcagagaaaaatgggcgtgaga 109  Q
    ||||||||||||||||||||||||||||||||||||||||||  |||||||| ||||||||||||||||||||||| |||||||||||||||||||||||    
11075260 tcgtcacttggttttttagaagggtaactggagtgagagaga--agagggactgaaaatggaagatgaatttctcagatcagagaaaaatgggcgtgaga 11075163  T
110 tgatagnnnnnnnnnnnnnnnnacaaaaggcaaggaaatagttttgttagggatggttcagatgcctttggattgagaagagtgggtaagattgaagcca 209  Q
    ||||||                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||    
11075162 tgataggggagagagagaga--acaaaaggcaaggaaatagttttgttagggatggttcagatgcctttggattgagaagaatgggtaagattgatgcca 11075065  T
210 aattttgagccatgtgcatgcctcggaaagaagcaagcattgaatgtttgatggaacaccaatgtttgatggataaaagcgaagggatttgaaatttgaa 309  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| || ||||||||||||||||||||    
11075064 aattttgagccatgtgcatgcctcggaaagaagcaagcattgaatgtttgatggaataccaatgtttgatggataacagtgaagggatttgaaatttgaa 11074965  T
310 ttgtacattaagtgcagttaaagcaaagttttcccgctctaaatcaaggattagggtttttaggtcttctgtgcattgtacattaggattggatataaag 409  Q
    |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||    
11074964 ttgtacattaagtgtagttaaagcaaagttttcccgctctaaatcaaggattagggtttttaggtcttgtgtgcattgtacattaggattagatataaag 11074865  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 427 - 461
Target Start/End: Complemental strand, 4333680 - 4333646
Alignment:
427 aaggatattttagtaatttacttaatttattatcg 461  Q
    |||||||||||||||||||| ||||||||||||||    
4333680 aaggatattttagtaatttaattaatttattatcg 4333646  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 427 - 461
Target Start/End: Complemental strand, 4333884 - 4333850
Alignment:
427 aaggatattttagtaatttacttaatttattatcg 461  Q
    |||||||||||||||||||| ||||||||||||||    
4333884 aaggatattttagtaatttaattaatttattatcg 4333850  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 431 - 459
Target Start/End: Original strand, 10972956 - 10972984
Alignment:
431 atattttagtaatttacttaatttattat 459  Q
    |||||||||||||||||||||||||||||    
10972956 atattttagtaatttacttaatttattat 10972984  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 427 - 459
Target Start/End: Complemental strand, 32923144 - 32923112
Alignment:
427 aaggatattttagtaatttacttaatttattat 459  Q
    |||||||||||||||||||| ||||||||||||    
32923144 aaggatattttagtaatttagttaatttattat 32923112  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 253; Significance: 1e-140; HSPs: 13)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 253; E-Value: 1e-140
Query Start/End: Original strand, 1 - 408
Target Start/End: Complemental strand, 33865982 - 33865601
Alignment:
1 cttgtgatatcgtcacttggttttttagaagggtaactggagtgagagagagaagagggacggaaaatggaagatgaatttctcatatcagagaaaaatg 100  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||  |||||||| ||||||||||||||||||||||| ||||||||||||||    
33865982 cttgtgatatcgtcacttgattttttagaagggtaactggagtgagagaga--agagggactgaaaatggaagatgaatttctcagatcagagaaaaatg 33865885  T
101 ggcgtgagatgatagnnnnnnnnnnnnnnnnacaaaaggcaaggaaatagttttgttagggatggttcagatgcctttggattgagaagagtgggtaaga 200  Q
    |||||||||||||||                |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
33865884 ggcgtgagatgataggagagagaga------acaaaaggcaaggaaatagttttgttagggatggttcagatgcctttgaattgagaagagtgggtaaga 33865791  T
201 ttgaagccaaattttgagccatgtgcatgcctcggaaagaagcaagcattgaatgtttgatggaacaccaatgtttgatggataaaagcgaagggatttg 300  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||                  |||||||||| |||||||||||    
33865790 ttgaagccaaattttgagccatgtgcatgcctcggaaagaagcaagcattgaatgtttga------------------tggataaaagtgaagggatttg 33865709  T
301 aaatttgaattgtacattaagtgcagttaaagcaaagttttcccgctctaaatcaaggattagggtttttaggtcttctgtgcattgtacattaggattg 400  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||     
33865708 aaatttgaattgtacattaagtgcagttaaagcaaagttttcccgctctaaatcaaagattagggtttttaggtcttgtgtgcattgtacattaggatta 33865609  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 142; E-Value: 3e-74
Query Start/End: Original strand, 132 - 369
Target Start/End: Original strand, 5790347 - 5790584
Alignment:
132 acaaaaggcaaggaaatagttttgttagggatggttcagatgcctttggattgagaagagtgggtaagattgaagccaaattttgagccatgtgcatgcc 231  Q
    |||||||||||||| ||||||||||||||||||||||| |||| ||||||||||||||||||||||| ||| ||||||| |||||||||||||||||  |    
5790347 acaaaaggcaaggagatagttttgttagggatggttcaaatgcatttggattgagaagagtgggtaacatttaagccaatttttgagccatgtgcatatc 5790446  T
232 tcggaaagaagcaagcattgaatgtttgatggaacaccaatgtttgatggataaaagcgaagggatttgaaatttgaattgtacattaagtgcagttaaa 331  Q
    |||||||||| | ||||||||||||||||||||| ||||||||||||||| ||| || ||||||||||||||||  |||| ||||||||||| ||||||     
5790447 tcggaaagaaccgagcattgaatgtttgatggaataccaatgtttgatgggtaacagtgaagggatttgaaattgaaattttacattaagtgtagttaag 5790546  T
332 gcaaagttttcccgctctaaatcaaggattagggtttt 369  Q
    ||| | ||||||||||  ||||| ||||||||||||||    
5790547 gcagaattttcccgcttaaaatctaggattagggtttt 5790584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 418 - 460
Target Start/End: Complemental strand, 2455692 - 2455650
Alignment:
418 tatataaacaaggatattttagtaatttacttaatttattatc 460  Q
    |||||| | ||||||||||||||||||||||||||||||||||    
2455692 tatatatataaggatattttagtaatttacttaatttattatc 2455650  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 416 - 458
Target Start/End: Original strand, 7844583 - 7844625
Alignment:
416 tatatataaacaaggatattttagtaatttacttaatttatta 458  Q
    |||||||| ||| ||||||||||||||||||||||||||||||    
7844583 tatatatacacatggatattttagtaatttacttaatttatta 7844625  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 416 - 458
Target Start/End: Original strand, 7845953 - 7845995
Alignment:
416 tatatataaacaaggatattttagtaatttacttaatttatta 458  Q
    |||||||| ||| ||||||||||||||||||||||||||||||    
7845953 tatatatacacatggatattttagtaatttacttaatttatta 7845995  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 429 - 461
Target Start/End: Original strand, 2619716 - 2619748
Alignment:
429 ggatattttagtaatttacttaatttattatcg 461  Q
    |||||||||||||||||||||||||||||||||    
2619716 ggatattttagtaatttacttaatttattatcg 2619748  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 431 - 463
Target Start/End: Complemental strand, 21859222 - 21859190
Alignment:
431 atattttagtaatttacttaatttattatcggg 463  Q
    |||||||||||||||||||||||||||||||||    
21859222 atattttagtaatttacttaatttattatcggg 21859190  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 427 - 463
Target Start/End: Complemental strand, 45885185 - 45885149
Alignment:
427 aaggatattttagtaatttacttaatttattatcggg 463  Q
    ||||||||||||||||||| |||||||||||||||||    
45885185 aaggatattttagtaatttgcttaatttattatcggg 45885149  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 416 - 463
Target Start/End: Complemental strand, 23406333 - 23406286
Alignment:
416 tatatataaacaaggatattttagtaatttacttaatttattatcggg 463  Q
    |||||||| ||| | |||||||||||||||||||||||||||| ||||    
23406333 tatatatacacatgaatattttagtaatttacttaatttattaacggg 23406286  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 416 - 463
Target Start/End: Complemental strand, 30603864 - 30603817
Alignment:
416 tatatataaacaaggatattttagtaatttacttaatttattatcggg 463  Q
    |||||||| ||| ||||||||||||||||||| |||||||||| ||||    
30603864 tatatatacacatggatattttagtaatttacataatttattaacggg 30603817  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 416 - 463
Target Start/End: Complemental strand, 41349715 - 41349668
Alignment:
416 tatatataaacaaggatattttagtaatttacttaatttattatcggg 463  Q
    |||||||| ||||  |||||||||||||||| ||||||||||||||||    
41349715 tatatatacacaaaaatattttagtaatttatttaatttattatcggg 41349668  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 431 - 463
Target Start/End: Complemental strand, 778558 - 778526
Alignment:
431 atattttagtaatttacttaatttattatcggg 463  Q
    |||||||||| ||||||||||||||||||||||    
778558 atattttagtcatttacttaatttattatcggg 778526  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 415 - 463
Target Start/End: Complemental strand, 38032140 - 38032092
Alignment:
415 atatatataaacaaggatattttagtaatttacttaatttattatcggg 463  Q
    ||||||||| | ||||| ||||||||| |||| ||||||||||||||||    
38032140 atatatatatataaggaaattttagtagtttagttaatttattatcggg 38032092  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0524 (Bit Score: 119; Significance: 2e-60; HSPs: 1)
Name: scaffold0524
Description:

Target: scaffold0524; HSP #1
Raw Score: 119; E-Value: 2e-60
Query Start/End: Original strand, 141 - 404
Target Start/End: Complemental strand, 5405 - 5140
Alignment:
141 aaggaaatagttttgttagggatggttcagatgcctttggattgagaagagtgggtaagattgaagccaaattttgagccatgtgcatgcctcggaaaga 240  Q
    ||||||||||||||  || || |||||||||||||||| |||||||||||||| || | ||||||||||| |||||||||||||||||||||| ||||||    
5405 aaggaaatagtttttctatggttggttcagatgcctttagattgagaagagtgagtcacattgaagccaatttttgagccatgtgcatgcctcagaaaga 5306  T
241 agcaagcattgaatgtttgatggaacaccaatgtttgatggataaaagcgaagggatttgaaatttgaattgtacattaagtgcagttaaagcaaagttt 340  Q
    ||| ||||||||||||||||| ||| ||||||||| ||||||||| || |||||||||||||||| |||||  ||| |||||| |||||| ||| | |||    
5305 agcgagcattgaatgtttgattgaataccaatgttagatggataatagtgaagggatttgaaattggaatttaacaataagtgtagttaaggcagaattt 5206  T
341 tcccgctctaaatcaaggattagggt--ttttaggtcttctgtgcattgtacattaggattggata 404  Q
    ||| ||||  |||| ||| |||||||  |||||| |||| | | ||||||||||||||||| ||||    
5205 tcctgctcataatctaggtttagggtttttttagatcttgtttacattgtacattaggattagata 5140  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 93; Significance: 5e-45; HSPs: 12)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 93; E-Value: 5e-45
Query Start/End: Original strand, 145 - 281
Target Start/End: Complemental strand, 7135078 - 7134942
Alignment:
145 aaatagttttgttagggatggttcagatgcctttggattgagaagagtgggtaagattgaagccaaattttgagccatgtgcatgcctcggaaagaagca 244  Q
    ||||||||||| || || |||||||||||||||||||| ||||||||||||||| ||||||||||| |||||| ||||||||||||||| |||||||||     
7135078 aaatagttttgctatggctggttcagatgcctttggatcgagaagagtgggtaacattgaagccaatttttgacccatgtgcatgcctcagaaagaagcg 7134979  T
245 agcattgaatgtttgatggaacaccaatgtttgatgg 281  Q
    |||||||||| |||||||||| |||||||||||||||    
7134978 agcattgaatatttgatggaataccaatgtttgatgg 7134942  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 322 - 399
Target Start/End: Complemental strand, 34703858 - 34703780
Alignment:
322 tgcagttaaagcaaagttttcccgctctaaatcaaggattagggt-ttttaggtcttctgtgcattgtacattaggatt 399  Q
    |||| |||||||||| ||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||||||||||    
34703858 tgcatttaaagcaaatttttcccgctcaaaatcaaggattagggttttttaggtcttgtgtgcattgtacattaggatt 34703780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 46 - 101
Target Start/End: Complemental strand, 7135342 - 7135287
Alignment:
46 gagagagaagagggacggaaaatggaagatgaatttctcatatcagagaaaaatgg 101  Q
    |||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
7135342 gagagagaagagggactgaaaatggaagatgaatttctcatatcagagaaaaatgg 7135287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 170 - 227
Target Start/End: Original strand, 42499085 - 42499142
Alignment:
170 gatgcctttggattgagaagagtgggtaagattgaagccaaattttgagccatgtgca 227  Q
    |||||||||| |||| ||||||||||||| |||||||| || |||||||| |||||||    
42499085 gatgcctttgcattgtgaagagtgggtaacattgaagctaatttttgagctatgtgca 42499142  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 427 - 459
Target Start/End: Complemental strand, 221277 - 221245
Alignment:
427 aaggatattttagtaatttacttaatttattat 459  Q
    |||||||||||||||||||||||||||||||||    
221277 aaggatattttagtaatttacttaatttattat 221245  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 427 - 463
Target Start/End: Complemental strand, 1143180 - 1143144
Alignment:
427 aaggatattttagtaatttacttaatttattatcggg 463  Q
    ||||||||| |||||||||||||||||||||||||||    
1143180 aaggatattctagtaatttacttaatttattatcggg 1143144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 427 - 463
Target Start/End: Complemental strand, 34442282 - 34442246
Alignment:
427 aaggatattttagtaatttacttaatttattatcggg 463  Q
    |||||||||||| ||||||||||||||||||||||||    
34442282 aaggatattttaataatttacttaatttattatcggg 34442246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 431 - 462
Target Start/End: Complemental strand, 27871840 - 27871809
Alignment:
431 atattttagtaatttacttaatttattatcgg 462  Q
    ||||||||||||||||||||||||||||||||    
27871840 atattttagtaatttacttaatttattatcgg 27871809  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 429 - 458
Target Start/End: Complemental strand, 42432793 - 42432764
Alignment:
429 ggatattttagtaatttacttaatttatta 458  Q
    ||||||||||||||||||||||||||||||    
42432793 ggatattttagtaatttacttaatttatta 42432764  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 430 - 479
Target Start/End: Complemental strand, 46394868 - 46394820
Alignment:
430 gatattttagtaatttacttaatttattatcggggtatggatttccgtag 479  Q
    ||||||||||| ||||||||||||||| ||| |||||||||| |||||||    
46394868 gatattttagtcatttacttaatttatcatc-gggtatggatatccgtag 46394820  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 431 - 463
Target Start/End: Original strand, 49408420 - 49408452
Alignment:
431 atattttagtaatttacttaatttattatcggg 463  Q
    |||||||||||||||||||||||||||| ||||    
49408420 atattttagtaatttacttaatttattaacggg 49408452  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 429 - 457
Target Start/End: Original strand, 49411165 - 49411193
Alignment:
429 ggatattttagtaatttacttaatttatt 457  Q
    |||||||||||||||||||||||||||||    
49411165 ggatattttagtaatttacttaatttatt 49411193  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 55; Significance: 3e-22; HSPs: 6)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 322 - 399
Target Start/End: Original strand, 28549343 - 28549421
Alignment:
322 tgcagttaaagcaaagttttcccgctctaaatcaaggattaggg-tttttaggtcttctgtgcattgtacattaggatt 399  Q
    |||| |||||||||| ||||||||||| |||||||||||||||| |||||||||||| |||||||||||||||||||||    
28549343 tgcatttaaagcaaatttttcccgctcaaaatcaaggattagggttttttaggtcttgtgtgcattgtacattaggatt 28549421  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 322 - 399
Target Start/End: Complemental strand, 41867075 - 41866997
Alignment:
322 tgcagttaaagcaaagttttcccgctctaaatcaaggattagggt-ttttaggtcttctgtgcattgtacattaggatt 399  Q
    |||| |||||||||| ||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||||||||||    
41867075 tgcatttaaagcaaatttttcccgctcaaaatcaaggattagggttttttaggtcttgtgtgcattgtacattaggatt 41866997  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 430 - 462
Target Start/End: Complemental strand, 12417071 - 12417039
Alignment:
430 gatattttagtaatttacttaatttattatcgg 462  Q
    |||||||||||||||||||||||||||||||||    
12417071 gatattttagtaatttacttaatttattatcgg 12417039  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 416 - 463
Target Start/End: Complemental strand, 34288448 - 34288401
Alignment:
416 tatatataaacaaggatattttagtaatttacttaatttattatcggg 463  Q
    |||||||| ||| ||||||||||||||||||||||| |||||| ||||    
34288448 tatatatacacatggatattttagtaatttacttaaattattaacggg 34288401  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 425 - 463
Target Start/End: Complemental strand, 17586190 - 17586152
Alignment:
425 acaaggatattttagtaatttacttaatttattatcggg 463  Q
    ||||||||||||||||||| || ||||||||||||||||    
17586190 acaaggatattttagtaatatatttaatttattatcggg 17586152  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 430 - 463
Target Start/End: Complemental strand, 16543737 - 16543704
Alignment:
430 gatattttagtaatttacttaatttattatcggg 463  Q
    |||||| |||||||||||||||||||||||||||    
16543737 gatattgtagtaatttacttaatttattatcggg 16543704  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 48; Significance: 4e-18; HSPs: 8)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 46 - 101
Target Start/End: Complemental strand, 17831287 - 17831232
Alignment:
46 gagagagaagagggacggaaaatggaagatgaatttctcatatcagagaaaaatgg 101  Q
    |||||||||||||||| ||||||||||||||||||||||| |||||||||||||||    
17831287 gagagagaagagggactgaaaatggaagatgaatttctcagatcagagaaaaatgg 17831232  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 141 - 204
Target Start/End: Complemental strand, 17831201 - 17831138
Alignment:
141 aaggaaatagttttgttagggatggttcagatgcctttggattgagaagagtgggtaagattga 204  Q
    ||||||||||||||| || || ||||||| |||||||||||||||||||||||||||| |||||    
17831201 aaggaaatagttttgctatggctggttcacatgcctttggattgagaagagtgggtaacattga 17831138  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 415 - 463
Target Start/End: Original strand, 25920904 - 25920952
Alignment:
415 atatatataaacaaggatattttagtaatttacttaatttattatcggg 463  Q
    ||||||||| ||| |||||||||||||||||||||||||||||| ||||    
25920904 atatatatacacatggatattttagtaatttacttaatttattaacggg 25920952  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 427 - 463
Target Start/End: Complemental strand, 12698769 - 12698733
Alignment:
427 aaggatattttagtaatttacttaatttattatcggg 463  Q
    ||||||||||||||||| |||||||||||||||||||    
12698769 aaggatattttagtaatctacttaatttattatcggg 12698733  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 430 - 460
Target Start/End: Complemental strand, 4622551 - 4622521
Alignment:
430 gatattttagtaatttacttaatttattatc 460  Q
    |||||||||||||||||||||||||||||||    
4622551 gatattttagtaatttacttaatttattatc 4622521  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 430 - 463
Target Start/End: Original strand, 15676179 - 15676212
Alignment:
430 gatattttagtaatttacttaatttattatcggg 463  Q
    |||||||||||||||||||| |||||||||||||    
15676179 gatattttagtaatttacttgatttattatcggg 15676212  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 430 - 463
Target Start/End: Complemental strand, 17841584 - 17841551
Alignment:
430 gatattttagtaatttacttaatttattatcggg 463  Q
    ||||||||| ||||||||||||||||||||||||    
17841584 gatattttattaatttacttaatttattatcggg 17841551  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 435 - 463
Target Start/End: Complemental strand, 30953953 - 30953925
Alignment:
435 tttagtaatttacttaatttattatcggg 463  Q
    |||||||||||||||||||||||||||||    
30953953 tttagtaatttacttaatttattatcggg 30953925  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0057 (Bit Score: 39; Significance: 0.0000000000009; HSPs: 1)
Name: scaffold0057
Description:

Target: scaffold0057; HSP #1
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 425 - 463
Target Start/End: Original strand, 49965 - 50003
Alignment:
425 acaaggatattttagtaatttacttaatttattatcggg 463  Q
    |||||||||||||||||||||||||||||||||||||||    
49965 acaaggatattttagtaatttacttaatttattatcggg 50003  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 38; Significance: 0.000000000004; HSPs: 5)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 418 - 463
Target Start/End: Complemental strand, 1864648 - 1864603
Alignment:
418 tatataaacaaggatattttagtaatttacttaatttattatcggg 463  Q
    |||||| | |||||||||||||||||||||||||||||||||||||    
1864648 tatatatataaggatattttagtaatttacttaatttattatcggg 1864603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 339 - 404
Target Start/End: Original strand, 30441298 - 30441364
Alignment:
339 tttcccgctctaaatcaaggattagggtttt-taggtcttctgtgcattgtacattaggattggata 404  Q
    |||||||||||||||| ||| ||||||||||  |||| || ||||||||||||||||||||| ||||    
30441298 tttcccgctctaaatctaggtttagggttttagaggtgttgtgtgcattgtacattaggattagata 30441364  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 430 - 463
Target Start/End: Original strand, 16855861 - 16855894
Alignment:
430 gatattttagtaatttacttaatttattatcggg 463  Q
    ||||||||||||||||||||||||||||||||||    
16855861 gatattttagtaatttacttaatttattatcggg 16855894  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 415 - 458
Target Start/End: Original strand, 35796880 - 35796923
Alignment:
415 atatatataaacaaggatattttagtaatttacttaatttatta 458  Q
    |||||||||  || ||||||||||||||||||||||||||||||    
35796880 atatatatacccatggatattttagtaatttacttaatttatta 35796923  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 427 - 459
Target Start/End: Complemental strand, 1945116 - 1945084
Alignment:
427 aaggatattttagtaatttacttaatttattat 459  Q
    ||||||||||||||||| |||||||||||||||    
1945116 aaggatattttagtaatatacttaatttattat 1945084  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 35; Significance: 0.0000000002; HSPs: 5)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 315 - 369
Target Start/End: Original strand, 1605287 - 1605341
Alignment:
315 cattaagtgcagttaaagcaaagttttcccgctctaaatcaaggattagggtttt 369  Q
    |||||||||  ||||| ||| | ||||||||||||||||||||||||||||||||    
1605287 cattaagtgtggttaatgcataattttcccgctctaaatcaaggattagggtttt 1605341  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 415 - 463
Target Start/End: Complemental strand, 16027789 - 16027741
Alignment:
415 atatatataaacaaggatattttagtaatttacttaatttattatcggg 463  Q
    ||||||||| ||| ||||||||||||||||||||| |||||||| ||||    
16027789 atatatatacacatggatattttagtaatttacttgatttattaacggg 16027741  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 418 - 458
Target Start/End: Original strand, 23399182 - 23399222
Alignment:
418 tatataaacaaggatattttagtaatttacttaatttatta 458  Q
    |||||| ||| ||||||||||||||||||||||||||||||    
23399182 tatatacacatggatattttagtaatttacttaatttatta 23399222  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 429 - 463
Target Start/End: Original strand, 5200184 - 5200218
Alignment:
429 ggatattttagtaatttacttaatttattatcggg 463  Q
    |||||||||||||||||||||||||||||| ||||    
5200184 ggatattttagtaatttacttaatttattaacggg 5200218  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 427 - 460
Target Start/End: Original strand, 33359423 - 33359456
Alignment:
427 aaggatattttagtaatttacttaatttattatc 460  Q
    |||||||||||||||||||||||||| |||||||    
33359423 aaggatattttagtaatttacttaatatattatc 33359456  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 105952 times since January 2019
Visitors: 1319