View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5_2_14 (Length: 410)

Name: J5_2_14
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5_2_14
J5_2_14
[»] chr3 (4 HSPs)
chr3 (153-410)||(43893095-43893352)
chr3 (1-160)||(43893348-43893507)
chr3 (209-409)||(43903743-43903943)
chr3 (1-151)||(43903940-43904091)


Alignment Details
Target: chr3 (Bit Score: 258; Significance: 1e-143; HSPs: 4)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 258; E-Value: 1e-143
Query Start/End: Original strand, 153 - 410
Target Start/End: Original strand, 43893095 - 43893352
Alignment:
153 attaattagcatcttagctcaaagttccttattattttccccatcatcacataaagcaccacacacttcaaagccttcttctgctcatttatgaaattca 252  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43893095 attaattagcatcttagctcaaagttccttattattttccccatcatcacataaagcaccacacacttcaaagccttcttctgctcatttatgaaattca 43893194  T
253 agtacaggcaaataaggatcaatatggaaggcacggaaacttttaaaaccagcagaaatgccaagttgtttgaattgttcttcagttctgtgttttccct 352  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43893195 agtacaggcaaataaggatcaatatggaaggcacggaaacttttaaaaccagcagaaatgccaagttgtttgaattgttcttcagttctgtgttttccct 43893294  T
353 tggttctatacattgtcattatccatatgtcagctgccaacaatgctcttgttctttt 410  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43893295 tggttctatacattgtcattatccatatgtcagctgccaacaatgctcttgttctttt 43893352  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 160; E-Value: 4e-85
Query Start/End: Original strand, 1 - 160
Target Start/End: Original strand, 43893348 - 43893507
Alignment:
1 cttttactctcatcggtctgctccggtaacaccggttcacaaagaatcaattttccggccaccggaagagccttgtaacaactttgcaaggccttcttga 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43893348 cttttactctcatcggtctgctccggtaacaccggttcacaaagaatcaattttccggccaccggaagagccttgtaacaactttgcaaggccttcttga 43893447  T
101 attcttcatctgtccatgttaacactgtccactgcaaaacaataattatactattaatta 160  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43893448 attcttcatctgtccatgttaacactgtccactgcaaaacaataattatactattaatta 43893507  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 121; E-Value: 7e-62
Query Start/End: Original strand, 209 - 409
Target Start/End: Original strand, 43903743 - 43903943
Alignment:
209 caccacacacttcaaagccttcttctgctcatttatgaaattcaagtacaggcaaataaggatcaatatggaaggcacggaaacttttaaaaccagcaga 308  Q
    |||| |||||||||||| |||||||||||||||| |||||||| || ||||| |||||||||||||| ||||||||||| ||||    ||||||||||||    
43903743 caccgcacacttcaaaggcttcttctgctcatttctgaaattctagaacaggaaaataaggatcaatgtggaaggcacgaaaacgaagaaaaccagcaga 43903842  T
309 aatgccaagttgtttgaattgttcttcagttctgtgttttcccttggttctatacattgtcattatccatatgtcagctgccaacaatgctcttgttctt 408  Q
    ||||||||| ||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||  |||||||| | | |||||||||||||||||||    
43903843 aatgccaagctgtttgaattgttcttcagttctgtgttttcccttagttttatacattgtcattatgaatatgtcacccgacaacaatgctcttgttctt 43903942  T
409 t 409  Q
    |    
43903943 t 43903943  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 1 - 151
Target Start/End: Original strand, 43903940 - 43904091
Alignment:
1 cttttactctcatcggtctgctccggtaacaccggttcacaaagaatcaattttccggccaccggaagagccttgtaacaactttgcaaggccttcttga 100  Q
    |||| ||||||||||||| |||||||| |||| || ||||||| |||||||||||||  |||||||||||||||||| ||  | |||||| ||||||||     
43903940 ctttgactctcatcggtcagctccggtgacactggctcacaaacaatcaattttccgttcaccggaagagccttgtagcagttctgcaagaccttcttgc 43904039  T
101 attcttcatctgtccatgttaacactgtccactgcaaaa-caataattatac 151  Q
    |||||||||||||||||||||||| ||||||||||||||  |||||||||||    
43904040 attcttcatctgtccatgttaacattgtccactgcaaaataaataattatac 43904091  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 106055 times since January 2019
Visitors: 1319