View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5_2_19 (Length: 638)

Name: J5_2_19
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5_2_19
J5_2_19
[»] chr1 (5 HSPs)
chr1 (184-612)||(26823449-26823878)
chr1 (197-557)||(26799370-26799730)
chr1 (1-190)||(26823885-26824074)
chr1 (247-560)||(26786644-26786957)
chr1 (232-434)||(26833418-26833620)
[»] chr7 (1 HSPs)
chr7 (254-329)||(41916817-41916892)


Alignment Details
Target: chr1 (Bit Score: 386; Significance: 0; HSPs: 5)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 386; E-Value: 0
Query Start/End: Original strand, 184 - 612
Target Start/End: Original strand, 26823449 - 26823878
Alignment:
184 tattaatgagagaagaaagttgtgcttttaaaagttgactttaaaatgaaaaagtcaacattaaaaattcacctctctttcattgtacattgggatctgg 283  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26823449 tattaatgagagaagaaagttgtgcttttaaaagttgactttaaaatgaaaaagtcaacattaaaaattcacctctctttcattgtacattgggatctgg 26823548  T
284 acaagaaccatgggataataggagtttcccaactcaacatcatcctcaatagcctcaaatttataacgtttctctggtgttcttttaaacaacttcacat 383  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26823549 acaagaaccatgggataataggagtttcccaactcaacatcatcctcaatagcctcaaatttataacgtttctctggtgttcttttaaacaacttcacat 26823648  T
384 aacaaatgacaattgccatgtaaactttctcaaccaacattatcaatgacaaacctaagcacaaatacactgtccatctcaacattggcactatcaaagg 483  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26823649 aacaaatgacaattgccatgtaaactttctcaaccaacattatcaatgacaaacctaagcacaaatacactgtccatctcaacattggcactatcaaagg 26823748  T
484 ttctctgatattcttccatatgaacccaagttgcataacacctccttcccttgctactttaaatgcctccattttttggatcgacac-aatgggaaaggc 582  Q
    ||||||||||||||||||||||||| |||||||||||||| ||||||| ||||||||||||||||||||||||||||| ||| |||| ||||||||||||    
26823749 ttctctgatattcttccatatgaactcaagttgcataacaactccttcacttgctactttaaatgcctccattttttgtatcaacacaaatgggaaaggc 26823848  T
583 aatgacccccatgggtgaaatggaagctaa 612  Q
    |||||||| | ||| ||||||| |||||||    
26823849 aatgacccacttggttgaaatgaaagctaa 26823878  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 197 - 557
Target Start/End: Original strand, 26799370 - 26799730
Alignment:
197 agaaagttgtgcttttaaaagttgactttaaaatgaaaaagtcaacattaaaaattcacctctctttcattgtacattgggatctggacaagaaccatgg 296  Q
    ||||||||||| ||||||||| |||||||||||  |||||||||||||| |||||||||||||||||||||||||||||| |  || |||||||||||||    
26799370 agaaagttgtggttttaaaagctgactttaaaagtaaaaagtcaacattgaaaattcacctctctttcattgtacattggaacttgaacaagaaccatgg 26799469  T
297 gataataggagtttcccaactcaacatcatcctcaatagcctcaaatttataacgtttctctggtgttcttttaaacaacttcacataacaaatgacaat 396  Q
    ||||||  |||||||||||||||||||||||||||||||||| |||||||||||  |||||||||||||| |||||||||||||||||||||||||||||    
26799470 gataattagagtttcccaactcaacatcatcctcaatagccttaaatttataacacttctctggtgttctcttaaacaacttcacataacaaatgacaat 26799569  T
397 tgccatgtaaactttctcaaccaacattatcaatgacaaacctaagcacaaatacactgtccatctcaacattggcactatcaaaggttctctgatattc 496  Q
    ||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26799570 tgccatgtatactttttcaaccaacattatcaatgacaaacctaagcacaaatacactgtccatctcaacattggcactatcaaaggttctctgatattc 26799669  T
497 ttccatatgaacccaagttgcataacacctccttcccttgctactttaaatgcctccattt 557  Q
    |||||||||||| ||||||||||| || ||||||| |||||||||||||||||||||||||    
26799670 ttccatatgaactcaagttgcataccaactccttcacttgctactttaaatgcctccattt 26799730  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 190
Target Start/End: Original strand, 26823885 - 26824074
Alignment:
1 ttatggttccttatatataaagagaatagatgcaggacagaggaatgacagtgtaaagcaaataaaaggataatataaaaacaatgcatgtttgtgtgat 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26823885 ttatggttccttatatataaagagaatagatgcaggacagaggaatgacagtgtaaagcaaataaaaggataatataaaaacaatgcatgtttgtgtgat 26823984  T
101 tcagatttataagagctagaataaataaaaatatttttacatatagacaattttatccgtgacgatcggatcgaaccacaatttattaat 190  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26823985 tcagatttataagagctagaataaataaaaatatttttacatatagacaattttatccgtgacgatcggatcgaaccacaatttattaat 26824074  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 126; E-Value: 1e-64
Query Start/End: Original strand, 247 - 560
Target Start/End: Original strand, 26786644 - 26786957
Alignment:
247 aaaattcacctctctttcattgtacattgggatctggacaagaaccatgggataataggagtttcccaactcaacatcatcctcaatagcctcaaattta 346  Q
    ||||||||||||||||||||||||||||||||| || |||||||| || || ||||  |||||| |||||||||||||||||| ||||| |||  |||||    
26786644 aaaattcacctctctttcattgtacattgggatttgaacaagaacaatagggtaattagagttttccaactcaacatcatccttaatagtctcccattta 26786743  T
347 taacgtttctctggtgttcttttaaacaacttcacataacaaatgacaattgccatgtaaactttctcaaccaacattatcaatgacaaacctaagcaca 446  Q
    ||||||||||| |||||||||||||||||||||||  ||||||| |||||| ||||||||||| |||||||||| || ||||||||||  | || ||| |    
26786744 taacgtttctcaggtgttcttttaaacaacttcactaaacaaatcacaattcccatgtaaactatctcaaccaatatcatcaatgacatgcttaggcaga 26786843  T
447 aatacactgtccatctcaacattggcactatcaaaggttctctgatattcttccatatgaacccaagttgcataacacctccttcccttgctactttaaa 546  Q
     | ||||||    ||||| ||||||||| |||||||||||||| || ||| |||| || ||| ||||||||||| || ||||||| || ||||||| |||    
26786844 taaacactgcagctctcagcattggcacgatcaaaggttctcttattttcctccaaataaacgcaagttgcataccaactccttcactagctacttgaaa 26786943  T
547 tgcctccatttttt 560  Q
      ||||||| ||||    
26786944 cacctccatatttt 26786957  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 99; E-Value: 2e-48
Query Start/End: Original strand, 232 - 434
Target Start/End: Original strand, 26833418 - 26833620
Alignment:
232 aaaaagtcaacattaaaaattcacctctctttcattgtacattgggatctggacaagaaccatgggataataggagtttcccaactcaacatcatcctca 331  Q
    ||||| |||| ||| ||||||||||||||||||||| |||||||| |  || ||||||||||| || ||||  ||||||||||||||||||||||||| |    
26833418 aaaaaatcaatattgaaaattcacctctctttcattatacattggaacttgaacaagaaccatagggtaattagagtttcccaactcaacatcatcctta 26833517  T
332 atagcctcaaatttataacgtttctctggtgttcttttaaacaacttcacataacaaatgacaattgccatgtaaactttctcaaccaacattatcaatg 431  Q
    |||| |||  |||||||||||||||||||| ||||   |||||||||||||||| |||| |||||| ||||||||||| ||||||||||||| ||||| |    
26833518 atagtctcccatttataacgtttctctggttttctaccaaacaacttcacataagaaatcacaattcccatgtaaactctctcaaccaacatcatcaacg 26833617  T
432 aca 434  Q
    |||    
26833618 aca 26833620  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 36; Significance: 0.00000000006; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 254 - 329
Target Start/End: Complemental strand, 41916892 - 41916817
Alignment:
254 acctctctttcattgtacattgggatctggacaagaaccatgggataataggagtttcccaactcaacatcatcct 329  Q
    |||||||||||||||||||| || || || ||||||||||| |||||| | ||||| || ||||||| ||||||||    
41916892 acctctctttcattgtacataggtatttgaacaagaaccataggataacaagagttccctaactcaatatcatcct 41916817  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 110978 times since January 2019
Visitors: 1335