View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5_2_23 (Length: 571)

Name: J5_2_23
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5_2_23
J5_2_23
[»] chr7 (3 HSPs)
chr7 (268-537)||(30593600-30593868)
chr7 (134-273)||(30593180-30593319)
chr7 (1-60)||(30593393-30593452)


Alignment Details
Target: chr7 (Bit Score: 227; Significance: 1e-125; HSPs: 3)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 268 - 537
Target Start/End: Complemental strand, 30593868 - 30593600
Alignment:
268 attaataaatgcatcagatattttttaaagactttaaaaagtaannnnnnnatagaaattgtgccttgaatgcatcaagtattaaaatttccaataaata 367  Q
    ||||||||||||||||||||||||||||||||||||||||||||       |||||||||||||||||||||||||||||||||||||||||||||||||    
30593868 attaataaatgcatcagatattttttaaagactttaaaaagtaatttttttatagaaattgtgccttgaatgcatcaagtattaaaatttccaataaata 30593769  T
368 atttgttaattgagaattagcaaaacccaatttcacaagacaagtagacaaccttagatcgcgtaaccactaacaaccatatccggaacaaaataactta 467  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
30593768 atttgttaattgagaattagcaaaacccaatttcacaagacaagtagacaaccttagaccgcgtaaccactaacaaccatatccggaacaaaataactta 30593669  T
468 cgcacgcaggaacgaacaanctgnctctagtttctttcagtttgaagcgacccgtttnaagtcatggagg 537  Q
    ||||||||||||||||||| ||| ||||||||||||||||||||||||||| ||||| ||||||||||||    
30593668 cgcacgcaggaacgaacaatctgtctctagtttctttcagtttgaagcgactcgttt-aagtcatggagg 30593600  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 140; E-Value: 5e-73
Query Start/End: Original strand, 134 - 273
Target Start/End: Complemental strand, 30593319 - 30593180
Alignment:
134 gtgttaatggctttcacagtagttctgtttgcgacgcctgagaatcaattgagcagcgttggggaaggggaggaggatactcacacaagtgattccgcac 233  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30593319 gtgttaatggctttcacagtagttctgtttgcgacgcctgagaatcaattgagcagcgttggggaaggggaggaggatactcacacaagtgattccgcac 30593220  T
234 ttcaaggtaactgcttttgttatcaatcaatgacattaat 273  Q
    ||||||||||||||||||||||||||||||||||||||||    
30593219 ttcaaggtaactgcttttgttatcaatcaatgacattaat 30593180  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 1 - 60
Target Start/End: Complemental strand, 30593452 - 30593393
Alignment:
1 ctttccgcaccaccactctctctcatcgtccttctccttttcctctatcacctggtactc 60  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30593452 ctttccgcaccaccactctctctcatcgtccttctccttttcctctatcacctggtactc 30593393  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 105903 times since January 2019
Visitors: 1319