View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5_2_26 (Length: 402)

Name: J5_2_26
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5_2_26
J5_2_26
[»] chr2 (2 HSPs)
chr2 (196-402)||(5246198-5246404)
chr2 (3-172)||(5246402-5246571)
[»] chr8 (1 HSPs)
chr8 (109-171)||(3467704-3467766)
[»] chr4 (2 HSPs)
chr4 (109-162)||(43508841-43508894)
chr4 (120-171)||(33770396-33770447)
[»] chr3 (1 HSPs)
chr3 (109-171)||(39068941-39069001)
[»] chr7 (1 HSPs)
chr7 (118-171)||(21850200-21850254)
[»] chr6 (1 HSPs)
chr6 (113-166)||(9398534-9398587)


Alignment Details
Target: chr2 (Bit Score: 207; Significance: 1e-113; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 196 - 402
Target Start/End: Original strand, 5246198 - 5246404
Alignment:
196 ccaaaggggtttattagcaataacatagaaacacgaaactgggttaacttggcccaatactgaggcaggacaagagtccattgttaatcacaccccatat 295  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5246198 ccaaaggggtttattagcaataacatagaaacacgaaactgggttaacttggcccaatactgaggcaggacaagagtccattgttaatcacaccccatat 5246297  T
296 tttcatacagaaagttgttatttgaacaataaaaatatatcatattttagacatagtttgggcatccccctaatcttatcctagagagacatggtgtgga 395  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5246298 tttcatacagaaagttgttatttgaacaataaaaatatatcatattttagacatagtttgggcatccccctaatcttatcctagagagacatggtgtgga 5246397  T
396 tgataat 402  Q
    |||||||    
5246398 tgataat 5246404  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 166; E-Value: 1e-88
Query Start/End: Original strand, 3 - 172
Target Start/End: Original strand, 5246402 - 5246571
Alignment:
3 aatctgatatttaaacttggctattaacattctttgtaactcttgattaagagtagtgtgtggtgatacgtgtggacttgaagatttggatacatatctg 102  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
5246402 aatctgatatttaaacttggctattaacattctttgtaactcttgattaagagtagtgtatggtgatacgtgtggacttgaagatttggatacatatctg 5246501  T
103 attacacacacattcataaaaatgaatatcacataattatttaagaaacactcattatttaattattaat 172  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5246502 attacacacacattcataaaaatgaatatcacataattatttaagaaacactcattatttaattattaat 5246571  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 55; Significance: 2e-22; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 109 - 171
Target Start/End: Original strand, 3467704 - 3467766
Alignment:
109 cacacattcataaaaatgaatatcacataattatttaagaaacactcattatttaattattaa 171  Q
    ||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||    
3467704 cacacattcataaaaatgaatatcacataattaattaaaaaacactcattatttaattattaa 3467766  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 109 - 162
Target Start/End: Complemental strand, 43508894 - 43508841
Alignment:
109 cacacattcataaaaatgaatatcacataattatttaagaaacactcattattt 162  Q
    |||||| |||||||||||||||||||||||||| |||| |||||||||||||||    
43508894 cacacactcataaaaatgaatatcacataattaattaaaaaacactcattattt 43508841  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 120 - 171
Target Start/End: Original strand, 33770396 - 33770447
Alignment:
120 aaaaatgaatatcacataattatttaagaaacactcattatttaattattaa 171  Q
    ||||||||||||||||||||||||||| |||||| ||| |||||||||||||    
33770396 aaaaatgaatatcacataattatttaaaaaacacccatgatttaattattaa 33770447  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 109 - 171
Target Start/End: Complemental strand, 39069001 - 39068941
Alignment:
109 cacacattcataaaaatgaatatcacataattatttaagaaacactcattatttaattattaa 171  Q
    |||||| |||||||||||||||||||||||||| |||  ||| ||||||||||||||||||||    
39069001 cacacactcataaaaatgaatatcacataattaatta--aaaaactcattatttaattattaa 39068941  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 118 - 171
Target Start/End: Complemental strand, 21850254 - 21850200
Alignment:
118 ataaaaatgaatatcacataattattt-aagaaacactcattatttaattattaa 171  Q
    ||||||||||||||||||||||||||| || ||| | | ||||||||||||||||    
21850254 ataaaaatgaatatcacataattatttaaaaaaatatttattatttaattattaa 21850200  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 113 - 166
Target Start/End: Original strand, 9398534 - 9398587
Alignment:
113 cattcataaaaatgaatatcacataattatttaagaaacactcattatttaatt 166  Q
    |||||||| |||| |||||||||||||||||||| || || |||||| ||||||    
9398534 cattcatacaaataaatatcacataattatttaaaaagcattcattaattaatt 9398587  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 111173 times since January 2019
Visitors: 1335