View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5_2_27 (Length: 610)

Name: J5_2_27
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5_2_27
J5_2_27
[»] chr7 (2 HSPs)
chr7 (115-585)||(48885506-48885974)
chr7 (1-120)||(48886392-48886511)
[»] chr4 (1 HSPs)
chr4 (480-563)||(50675640-50675722)
[»] chr3 (1 HSPs)
chr3 (203-260)||(8091277-8091334)
[»] chr8 (2 HSPs)
chr8 (119-156)||(12196242-12196279)
chr8 (119-156)||(12440670-12440707)


Alignment Details
Target: chr7 (Bit Score: 382; Significance: 0; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 382; E-Value: 0
Query Start/End: Original strand, 115 - 585
Target Start/End: Original strand, 48885506 - 48885974
Alignment:
115 attaatttgcattttgatctacttgttgattggttcttattgaatcactaatgctgacagtgcatatttgaattggtggtgagttagcgaaatcacagtg 214  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
48885506 attaatttgcattttgatctacttgttgattggttcttattgaatcactaatgctaacagtgcatatttgaattggtggtgagttagcgaaatcacagtg 48885605  T
215 acactttgattttgttgaagttacaacgtgtaacttttaccaaaatcgtggaggtccatcgtgattttgtctaactctctctgaattcaaacatgcacac 314  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48885606 acactttgattttgttgaagttacaacgtgtaacttttaccaaaatcgtggaggtccatcgtgattttgtctaactctctctgaattcaaacatgcacac 48885705  T
315 aattatttaatttggagagaaaaactaaatcattttcacatggaattaacttggttcaaaattggtcgaattaactacacgagcatctgatatcgaagag 414  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48885706 aattatttaatttggagagaaaaactaaatcattttcacatggaattaacttggttcaaaattggtcgaattaactacacgagcatctgatatcgaagag 48885805  T
415 acataattttgttgatcatgttacaggtgaaatataaaaaggtagatcaa-nnnnnnnnnnnnctttcaaaatttgactgcccatgccaaattgacaatc 513  Q
    ||||||||||||||||||||||||||||||||||| ||||||||||||||             ||||||||||||||||||||||| |||||||||||||    
48885806 acataattttgttgatcatgttacaggtgaaatat-aaaaggtagatcaatttttatttttttctttcaaaatttgactgcccatg-caaattgacaatc 48885903  T
514 attcaagtggtgtgaattttagaagtgtttgccacnctagttcaaatgatgggttcattacnaaatggtttc 585  Q
    ||||||||| |||||||||||||||||||||| || |||||||||||||| |||||||||| ||||| ||||    
48885904 attcaagtgttgtgaattttagaagtgtttgcaacgctagttcaaatgat-ggttcattacaaaatgttttc 48885974  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 116; E-Value: 1e-58
Query Start/End: Original strand, 1 - 120
Target Start/End: Original strand, 48886392 - 48886511
Alignment:
1 tgtagcaattgaaatcaggcaatgcactactgcatatttgttgtgcctcatgtttaataacactaacaaactattacacaacgacatcaaactaaagcac 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48886392 tgtagcaattgaaatcaggcaatgcactactgcatatttgttgtgcctcatgtttaataacactaacaaactattacacaacgacatcaaactaaagcac 48886491  T
101 gatcacagtaaaaaattaat 120  Q
     |||||||||||||||||||    
48886492 aatcacagtaaaaaattaat 48886511  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 33; Significance: 0.000000004; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 480 - 563
Target Start/End: Original strand, 50675640 - 50675722
Alignment:
480 tcaaaatttgactgcccatgccaaattgacaatcattcaagtggtgtgaattttagaagtgtttgccacnctagttcaaatgat 563  Q
    ||||||||| |||| |||||| |||||||  |||||||||||| | ||||||||||||| || ||| |  ||||||||||||||    
50675640 tcaaaattttactggccatgc-aaattgatgatcattcaagtgttttgaattttagaagggtgtgcaatgctagttcaaatgat 50675722  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 31; Significance: 0.00000005; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 203 - 260
Target Start/End: Original strand, 8091277 - 8091334
Alignment:
203 gaaatcacagtgacactttgattttgttgaagttacaac-gtgtaacttttaccaaaat 260  Q
    |||||||| |||||||| |||||||||||||||| |||| ||||||||||| |||||||    
8091277 gaaatcacggtgacactgtgattttgttgaagtt-caacggtgtaacttttgccaaaat 8091334  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 30; Significance: 0.0000002; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 119 - 156
Target Start/End: Original strand, 12196242 - 12196279
Alignment:
119 atttgcattttgatctacttgttgattggttcttattg 156  Q
    |||| |||||||||||||||| ||||||||||||||||    
12196242 atttacattttgatctacttgatgattggttcttattg 12196279  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 119 - 156
Target Start/End: Original strand, 12440670 - 12440707
Alignment:
119 atttgcattttgatctacttgttgattggttcttattg 156  Q
    |||| |||||||||||||||| ||||||||||||||||    
12440670 atttacattttgatctacttgatgattggttcttattg 12440707  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 201770 times since January 2019
Visitors: 1513