View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5_2_28 (Length: 204)

Name: J5_2_28
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5_2_28
J5_2_28
[»] chr3 (131 HSPs)
chr3 (45-204)||(38891355-38891514)
chr3 (45-194)||(45344379-45344528)
chr3 (45-193)||(40479405-40479553)
chr3 (47-192)||(16126523-16126670)
chr3 (45-194)||(26541555-26541701)
chr3 (45-194)||(43739662-43739817)
chr3 (45-192)||(39470507-39470656)
chr3 (45-187)||(53779656-53779800)
chr3 (45-155)||(54671595-54671705)
chr3 (45-193)||(8873488-8873645)
chr3 (45-194)||(29717564-29717727)
chr3 (45-194)||(37088914-37089077)
chr3 (45-156)||(29080695-29080806)
chr3 (45-193)||(37528084-37528246)
chr3 (45-156)||(37713380-37713491)
chr3 (45-156)||(38186402-38186513)
chr3 (45-156)||(55227202-55227313)
chr3 (45-155)||(19947735-19947845)
chr3 (45-192)||(44748204-44748353)
chr3 (45-155)||(50316528-50316638)
chr3 (45-193)||(54541387-54541544)
chr3 (45-156)||(35500234-35500345)
chr3 (45-156)||(40562779-40562890)
chr3 (45-155)||(21707744-21707854)
chr3 (45-155)||(28676340-28676450)
chr3 (45-156)||(4240885-4240996)
chr3 (45-156)||(44846249-44846360)
chr3 (45-155)||(25571008-25571118)
chr3 (50-156)||(52795536-52795642)
chr3 (50-192)||(30549185-30549329)
chr3 (50-192)||(33392343-33392499)
chr3 (45-156)||(47897013-47897124)
chr3 (45-156)||(55304523-55304634)
chr3 (45-155)||(43526364-43526474)
chr3 (45-155)||(50500397-50500507)
chr3 (50-193)||(49852615-49852759)
chr3 (50-152)||(24536016-24536118)
chr3 (45-156)||(21604425-21604537)
chr3 (45-156)||(44545851-44545962)
chr3 (59-155)||(2852522-2852618)
chr3 (82-155)||(2579418-2579491)
chr3 (59-155)||(37712579-37712676)
chr3 (59-155)||(46972693-46972790)
chr3 (50-155)||(51003893-51003998)
chr3 (59-155)||(52165486-52165583)
chr3 (89-156)||(46247183-46247250)
chr3 (59-155)||(24627557-24627653)
chr3 (83-155)||(20451114-20451186)
chr3 (72-155)||(39720072-39720156)
chr3 (45-101)||(46247395-46247451)
chr3 (62-155)||(41519194-41519288)
chr3 (91-148)||(30865084-30865141)
chr3 (83-155)||(32025650-32025722)
chr3 (60-155)||(35100867-35100963)
chr3 (59-135)||(46626856-46626932)
chr3 (83-155)||(52594742-52594814)
chr3 (59-193)||(52858557-52858711)
chr3 (50-137)||(52867580-52867668)
chr3 (70-139)||(42218270-42218340)
chr3 (147-191)||(45369667-45369711)
chr3 (60-155)||(46318108-46318204)
chr3 (60-155)||(47175066-47175162)
chr3 (83-155)||(52226033-52226105)
chr3 (147-194)||(2579339-2579386)
chr3 (50-149)||(25599837-25599936)
chr3 (147-194)||(38186532-38186579)
chr3 (147-194)||(40562675-40562722)
chr3 (147-194)||(55227124-55227171)
chr3 (147-193)||(29080618-29080664)
chr3 (69-155)||(33895424-33895510)
chr3 (9-51)||(38891309-38891351)
chr3 (147-193)||(43526494-43526540)
chr3 (59-151)||(12063124-12063216)
chr3 (60-152)||(51990201-51990294)
chr3 (50-137)||(2812697-2812785)
chr3 (83-155)||(30813639-30813711)
chr3 (60-155)||(32981935-32982031)
chr3 (60-155)||(40932330-40932426)
chr3 (60-155)||(41246935-41247031)
chr3 (83-155)||(42463459-42463531)
chr3 (83-155)||(45692739-45692811)
chr3 (147-194)||(19947656-19947703)
chr3 (59-134)||(29202453-29202528)
chr3 (147-190)||(35500402-35500445)
chr3 (86-137)||(44806348-44806399)
chr3 (147-194)||(52594675-52594722)
chr3 (147-193)||(44946523-44946569)
chr3 (62-155)||(45369518-45369612)
chr3 (157-193)||(2852676-2852712)
chr3 (83-190)||(5507335-5507437)
chr3 (147-194)||(52165412-52165459)
chr3 (147-194)||(52867509-52867556)
chr3 (50-105)||(52930604-52930659)
chr3 (50-155)||(29756849-29756955)
chr3 (147-189)||(32025581-32025623)
chr3 (159-193)||(37713315-37713349)
chr3 (60-153)||(42497708-42497802)
chr3 (157-195)||(46972813-46972851)
chr3 (147-185)||(47896970-47897008)
chr3 (151-192)||(194179-194220)
chr3 (147-192)||(25571150-25571195)
chr3 (147-188)||(48943344-48943385)
chr3 (83-155)||(2122596-2122668)
chr3 (60-155)||(2599928-2600024)
chr3 (157-189)||(21707870-21707902)
chr3 (137-190)||(24535950-24536005)
chr3 (60-139)||(51709698-51709778)
chr3 (157-192)||(892754-892789)
chr3 (148-191)||(30813568-30813611)
chr3 (147-194)||(32981847-32981894)
chr3 (151-194)||(41519319-41519362)
chr3 (147-182)||(44545967-44546002)
chr3 (141-193)||(50500538-50500592)
chr3 (91-192)||(2186631-2186729)
chr3 (83-137)||(4071396-4071450)
chr3 (65-155)||(32839401-32839491)
chr3 (83-137)||(32999152-32999206)
chr3 (157-187)||(44846375-44846405)
chr3 (147-193)||(51709831-51709877)
chr3 (147-189)||(52226132-52226174)
chr3 (83-137)||(52959902-52959956)
chr3 (122-155)||(892731-892764)
chr3 (151-188)||(24627461-24627498)
chr3 (147-192)||(35101038-35101083)
chr3 (50-87)||(39719896-39719933)
chr3 (88-137)||(48747941-48747990)
chr3 (159-192)||(52795673-52795706)
chr3 (147-187)||(4241053-4241093)
chr3 (147-187)||(46318006-46318046)
chr3 (120-156)||(48943303-48943339)
chr3 (137-194)||(55304458-55304516)
[»] chr1 (134 HSPs)
chr1 (45-192)||(7710311-7710458)
chr1 (45-188)||(17047361-17047504)
chr1 (45-193)||(46370353-46370503)
chr1 (45-192)||(50170666-50170815)
chr1 (45-156)||(26204905-26205016)
chr1 (45-192)||(323498-323659)
chr1 (45-190)||(2498531-2498677)
chr1 (45-193)||(31149789-31149931)
chr1 (45-156)||(1918654-1918765)
chr1 (45-156)||(32367786-32367897)
chr1 (45-156)||(36300501-36300612)
chr1 (45-193)||(39827222-39827384)
chr1 (45-156)||(40888462-40888573)
chr1 (45-156)||(44910466-44910577)
chr1 (45-156)||(50351661-50351772)
chr1 (45-193)||(3271290-3271452)
chr1 (45-156)||(15313877-15313988)
chr1 (45-156)||(19898304-19898415)
chr1 (45-156)||(29586790-29586901)
chr1 (45-152)||(29703607-29703714)
chr1 (45-156)||(30721043-30721154)
chr1 (45-156)||(38677048-38677159)
chr1 (45-193)||(41150567-41150729)
chr1 (45-156)||(42063702-42063813)
chr1 (45-193)||(13120940-13121102)
chr1 (45-156)||(17499272-17499383)
chr1 (45-155)||(38966854-38966964)
chr1 (50-155)||(1507128-1507233)
chr1 (45-156)||(22099546-22099657)
chr1 (45-152)||(49219883-49219990)
chr1 (45-155)||(9169658-9169768)
chr1 (45-155)||(33525154-33525264)
chr1 (50-155)||(25602594-25602699)
chr1 (45-187)||(39583611-39583755)
chr1 (45-156)||(47133959-47134070)
chr1 (50-155)||(44718371-44718476)
chr1 (45-156)||(23710638-23710749)
chr1 (50-155)||(18346798-18346903)
chr1 (45-156)||(26844379-26844490)
chr1 (45-156)||(33561303-33561409)
chr1 (59-156)||(3661398-3661496)
chr1 (50-149)||(33152536-33152636)
chr1 (61-151)||(8220452-8220542)
chr1 (83-156)||(29379620-29379693)
chr1 (84-192)||(30779988-30780110)
chr1 (59-155)||(28867908-28868005)
chr1 (50-155)||(34087631-34087737)
chr1 (59-156)||(34320042-34320140)
chr1 (50-155)||(42964501-42964607)
chr1 (50-138)||(5698033-5698122)
chr1 (50-138)||(5698415-5698504)
chr1 (140-193)||(19898241-19898294)
chr1 (45-156)||(36838101-36838197)
chr1 (83-155)||(34319217-34319289)
chr1 (147-194)||(32367708-32367755)
chr1 (70-155)||(3391718-3391803)
chr1 (59-139)||(16084965-16085046)
chr1 (86-155)||(27658725-27658794)
chr1 (83-155)||(6814771-6814843)
chr1 (83-155)||(9769163-9769235)
chr1 (83-155)||(12892245-12892317)
chr1 (59-137)||(13570167-13570246)
chr1 (146-193)||(29703526-29703573)
chr1 (147-194)||(36300423-36300470)
chr1 (147-194)||(44910596-44910643)
chr1 (62-155)||(10628218-10628312)
chr1 (83-137)||(26063521-26063575)
chr1 (147-193)||(29379776-29379822)
chr1 (147-193)||(29586932-29586978)
chr1 (147-193)||(34319309-34319355)
chr1 (147-193)||(42063611-42063657)
chr1 (147-192)||(15314019-15314064)
chr1 (60-152)||(15349543-15349636)
chr1 (59-155)||(19716490-19716587)
chr1 (147-192)||(26205073-26205118)
chr1 (147-192)||(33561201-33561246)
chr1 (150-195)||(36838020-36838065)
chr1 (83-155)||(7025557-7025629)
chr1 (60-155)||(36378416-36378512)
chr1 (50-149)||(46087339-46087438)
chr1 (60-155)||(49184522-49184618)
chr1 (147-194)||(1918822-1918869)
chr1 (84-155)||(40720141-40720212)
chr1 (147-193)||(38677164-38677210)
chr1 (83-149)||(46928327-46928393)
chr1 (50-139)||(52702460-52702550)
chr1 (83-155)||(2022716-2022788)
chr1 (60-139)||(15732539-15732619)
chr1 (83-155)||(40934883-40934954)
chr1 (91-139)||(41650029-41650077)
chr1 (137-194)||(49219787-49219846)
chr1 (157-192)||(29683486-29683521)
chr1 (60-154)||(37704502-37704596)
chr1 (147-189)||(3661501-3661543)
chr1 (159-193)||(28867854-28867888)
chr1 (59-152)||(38619878-38619972)
chr1 (50-152)||(41004395-41004497)
chr1 (149-187)||(50351967-50352005)
chr1 (159-192)||(18346745-18346778)
chr1 (137-195)||(23710756-23710816)
chr1 (147-180)||(26844495-26844528)
chr1 (83-139)||(27257472-27257529)
chr1 (147-192)||(33152711-33152756)
chr1 (149-182)||(48375635-48375668)
chr1 (157-189)||(9169758-9169790)
chr1 (60-139)||(28429707-28429786)
chr1 (147-187)||(41762754-41762794)
chr1 (147-194)||(7780487-7780534)
chr1 (151-194)||(13570068-13570111)
chr1 (60-154)||(37671553-37671647)
chr1 (157-192)||(40888588-40888623)
chr1 (147-194)||(49239308-49239355)
chr1 (151-192)||(3408368-3408410)
chr1 (151-192)||(3438413-3438455)
chr1 (157-191)||(9768553-9768587)
chr1 (147-193)||(10721522-10721568)
chr1 (157-191)||(17499223-17499257)
chr1 (50-155)||(30494539-30494645)
chr1 (147-193)||(47049400-47049446)
chr1 (93-155)||(49239389-49239451)
chr1 (81-149)||(50541380-50541445)
chr1 (83-112)||(7780585-7780614)
chr1 (59-155)||(33632604-33632700)
chr1 (165-194)||(33632726-33632755)
chr1 (147-192)||(34087764-34087808)
chr1 (59-155)||(38596712-38596809)
chr1 (147-184)||(47133891-47133928)
chr1 (83-139)||(16474228-16474284)
chr1 (157-193)||(25602689-25602725)
chr1 (157-193)||(30720992-30721028)
chr1 (147-187)||(37671485-37671525)
chr1 (147-187)||(37704624-37704664)
chr1 (159-191)||(40934838-40934870)
chr1 (83-139)||(40942419-40942475)
[»] chr8 (113 HSPs)
chr8 (45-192)||(8271536-8271683)
chr8 (50-194)||(31497341-31497487)
chr8 (45-192)||(45140832-45140981)
chr8 (45-167)||(28709937-28710059)
chr8 (45-167)||(28717284-28717406)
chr8 (45-192)||(11740476-11740626)
chr8 (45-168)||(16423455-16423578)
chr8 (45-193)||(31687410-31687572)
chr8 (45-156)||(17082259-17082370)
chr8 (45-156)||(25023933-25024044)
chr8 (45-156)||(31582327-31582438)
chr8 (45-156)||(36680844-36680955)
chr8 (45-156)||(39871885-39871996)
chr8 (45-155)||(6338943-6339053)
chr8 (46-156)||(23415162-23415272)
chr8 (45-192)||(23677437-23677586)
chr8 (45-192)||(32541847-32542008)
chr8 (45-156)||(10619445-10619556)
chr8 (45-156)||(36112254-36112365)
chr8 (45-156)||(39319494-39319605)
chr8 (45-156)||(39702909-39703020)
chr8 (45-156)||(43276181-43276292)
chr8 (45-156)||(44826800-44826911)
chr8 (45-156)||(17116105-17116216)
chr8 (45-156)||(27781729-27781840)
chr8 (45-156)||(30338163-30338274)
chr8 (45-156)||(41314156-41314267)
chr8 (45-155)||(1893254-1893364)
chr8 (50-156)||(42203011-42203117)
chr8 (45-156)||(42142167-42142278)
chr8 (45-155)||(41693397-41693506)
chr8 (50-152)||(35242683-35242785)
chr8 (55-156)||(37586613-37586715)
chr8 (50-149)||(29189135-29189235)
chr8 (59-152)||(45152676-45152770)
chr8 (59-156)||(2641808-2641906)
chr8 (59-155)||(37559927-37560024)
chr8 (59-152)||(9211638-9211732)
chr8 (50-155)||(22877225-22877332)
chr8 (60-155)||(36590870-36590966)
chr8 (48-155)||(39746035-39746143)
chr8 (61-155)||(40046209-40046304)
chr8 (50-155)||(44157875-44157981)
chr8 (45-194)||(38170795-38170948)
chr8 (59-156)||(3512271-3512369)
chr8 (147-192)||(44826710-44826755)
chr8 (60-155)||(24666226-24666322)
chr8 (83-139)||(31523157-31523213)
chr8 (147-194)||(13970730-13970777)
chr8 (147-194)||(25024127-25024174)
chr8 (147-194)||(27781871-27781918)
chr8 (147-194)||(31582495-31582542)
chr8 (48-154)||(39746224-39746331)
chr8 (147-190)||(41314298-41314341)
chr8 (147-194)||(43276115-43276162)
chr8 (62-116)||(44264205-44264260)
chr8 (147-193)||(17116287-17116333)
chr8 (147-193)||(23415329-23415375)
chr8 (60-152)||(15278568-15278661)
chr8 (60-152)||(15458937-15459030)
chr8 (83-155)||(38782503-38782576)
chr8 (137-194)||(39319428-39319487)
chr8 (60-155)||(40222419-40222514)
chr8 (62-116)||(7379739-7379794)
chr8 (146-193)||(8435811-8435858)
chr8 (147-194)||(10619613-10619660)
chr8 (147-190)||(30338305-30338348)
chr8 (147-190)||(39872027-39872070)
chr8 (146-193)||(44318992-44319039)
chr8 (62-155)||(10653360-10653454)
chr8 (147-193)||(17082453-17082499)
chr8 (147-189)||(28710065-28710107)
chr8 (147-189)||(28717412-28717454)
chr8 (147-193)||(44158022-44158068)
chr8 (83-152)||(34394759-34394828)
chr8 (147-192)||(36112178-36112223)
chr8 (59-155)||(44318841-44318938)
chr8 (59-146)||(3427124-3427212)
chr8 (83-155)||(8435884-8435956)
chr8 (83-155)||(11297308-11297380)
chr8 (83-155)||(22958025-22958097)
chr8 (147-195)||(40046352-40046400)
chr8 (83-155)||(43848578-43848650)
chr8 (159-194)||(43848031-43848066)
chr8 (147-193)||(6339085-6339131)
chr8 (147-193)||(15278492-15278538)
chr8 (147-193)||(15458861-15458907)
chr8 (147-192)||(32467645-32467691)
chr8 (59-131)||(26294115-26294188)
chr8 (59-131)||(26307372-26307445)
chr8 (83-128)||(37782302-37782347)
chr8 (147-187)||(1363145-1363185)
chr8 (83-155)||(9339904-9339976)
chr8 (149-189)||(16423610-16423650)
chr8 (60-139)||(32100251-32100331)
chr8 (157-193)||(36680793-36680829)
chr8 (83-155)||(40552529-40552601)
chr8 (151-194)||(3427047-3427090)
chr8 (159-193)||(7379888-7379922)
chr8 (83-137)||(35252529-35252583)
chr8 (86-155)||(1363233-1363302)
chr8 (83-136)||(2111014-2111067)
chr8 (83-136)||(8407586-8407639)
chr8 (147-192)||(24666349-24666394)
chr8 (157-194)||(37961078-37961115)
chr8 (159-188)||(44264347-44264376)
chr8 (149-193)||(3512404-3512448)
chr8 (83-139)||(18531704-18531760)
chr8 (55-175)||(20516075-20516198)
chr8 (83-135)||(25099576-25099628)
chr8 (83-139)||(35020975-35021031)
chr8 (146-194)||(39703050-39703098)
chr8 (166-194)||(42142094-42142122)
[»] chr5 (111 HSPs)
chr5 (45-192)||(6603264-6603411)
chr5 (45-192)||(7652195-7652344)
chr5 (45-194)||(1710553-1710704)
chr5 (45-193)||(39276054-39276216)
chr5 (45-155)||(12363008-12363118)
chr5 (45-192)||(5592231-5592385)
chr5 (45-156)||(8023388-8023499)
chr5 (45-156)||(9160080-9160191)
chr5 (45-156)||(13227979-13228090)
chr5 (45-156)||(15531061-15531172)
chr5 (45-156)||(31168385-31168496)
chr5 (45-156)||(36686434-36686545)
chr5 (45-156)||(39743940-39744051)
chr5 (45-192)||(13156239-13156400)
chr5 (45-192)||(19955660-19955821)
chr5 (45-194)||(16856319-16856482)
chr5 (48-156)||(32383463-32383571)
chr5 (45-194)||(35235079-35235242)
chr5 (45-156)||(2672031-2672142)
chr5 (45-156)||(4220889-4221000)
chr5 (45-156)||(24801395-24801506)
chr5 (45-156)||(32381077-32381188)
chr5 (45-156)||(43403066-43403177)
chr5 (45-192)||(12713937-12714098)
chr5 (45-192)||(14646717-14646878)
chr5 (45-154)||(29391512-29391621)
chr5 (45-193)||(2179377-2179539)
chr5 (45-156)||(9586586-9586697)
chr5 (45-189)||(15444084-15444242)
chr5 (45-152)||(19526328-19526435)
chr5 (45-156)||(27130951-27131062)
chr5 (45-192)||(12775165-12775326)
chr5 (45-193)||(5997247-5997410)
chr5 (45-193)||(35640571-35640733)
chr5 (45-152)||(2235918-2236025)
chr5 (45-156)||(3036832-3036943)
chr5 (50-156)||(3669979-3670085)
chr5 (50-155)||(25871713-25871818)
chr5 (45-134)||(30300323-30300412)
chr5 (59-155)||(11100036-11100133)
chr5 (59-151)||(22653340-22653433)
chr5 (59-155)||(26698438-26698534)
chr5 (59-155)||(26968170-26968266)
chr5 (59-155)||(1175417-1175514)
chr5 (59-155)||(3670937-3671034)
chr5 (59-155)||(30773575-30773672)
chr5 (59-155)||(35235991-35236088)
chr5 (59-155)||(22976534-22976630)
chr5 (45-109)||(30412052-30412116)
chr5 (59-192)||(11663265-11663401)
chr5 (59-155)||(11061892-11061988)
chr5 (62-155)||(23921665-23921758)
chr5 (59-155)||(10697919-10698016)
chr5 (87-155)||(6350206-6350274)
chr5 (60-155)||(6892837-6892933)
chr5 (62-151)||(7897096-7897187)
chr5 (147-194)||(35235893-35235940)
chr5 (147-193)||(15531203-15531249)
chr5 (147-193)||(32383602-32383648)
chr5 (83-155)||(31408746-31408818)
chr5 (83-155)||(36027364-36027436)
chr5 (146-193)||(2235837-2235884)
chr5 (147-194)||(22653453-22653500)
chr5 (147-193)||(2672173-2672219)
chr5 (147-193)||(8023285-8023331)
chr5 (147-193)||(10698041-10698087)
chr5 (147-193)||(13227902-13227948)
chr5 (147-193)||(36686590-36686636)
chr5 (59-112)||(27870722-27870775)
chr5 (147-192)||(43403234-43403279)
chr5 (147-187)||(9586489-9586529)
chr5 (60-139)||(11780605-11780685)
chr5 (147-194)||(1175565-1175612)
chr5 (60-155)||(4379971-4380064)
chr5 (151-194)||(8285581-8285624)
chr5 (88-151)||(33695243-33695306)
chr5 (147-193)||(3671059-3671105)
chr5 (73-134)||(9397173-9397235)
chr5 (151-193)||(11061819-11061861)
chr5 (147-193)||(19348438-19348484)
chr5 (147-193)||(19526496-19526542)
chr5 (147-193)||(30773510-30773555)
chr5 (59-155)||(649306-649402)
chr5 (147-192)||(3036730-3036775)
chr5 (151-192)||(5381186-5381227)
chr5 (59-151)||(6279727-6279820)
chr5 (147-192)||(24801563-24801608)
chr5 (83-155)||(16475360-16475432)
chr5 (53-139)||(5522031-5522117)
chr5 (151-194)||(22976390-22976433)
chr5 (137-189)||(32381016-32381070)
chr5 (147-189)||(39743867-39743909)
chr5 (147-192)||(649457-649502)
chr5 (86-155)||(9626586-9626655)
chr5 (157-190)||(12362959-12362992)
chr5 (147-192)||(31168309-31168354)
chr5 (83-155)||(2498308-2498380)
chr5 (147-191)||(2498442-2498486)
chr5 (95-155)||(5381293-5381353)
chr5 (157-193)||(9160029-9160065)
chr5 (83-155)||(19348354-19348425)
chr5 (160-192)||(27868191-27868223)
chr5 (147-191)||(33695372-33695416)
chr5 (158-193)||(25871661-25871696)
chr5 (147-194)||(29391432-29391479)
chr5 (147-194)||(42321147-42321194)
chr5 (83-137)||(8285464-8285518)
chr5 (159-189)||(23921778-23921808)
chr5 (55-112)||(28330576-28330633)
chr5 (83-139)||(13947541-13947597)
chr5 (157-189)||(27131077-27131109)
[»] chr7 (96 HSPs)
chr7 (45-192)||(27089032-27089181)
chr7 (45-192)||(27189120-27189269)
chr7 (45-193)||(19831449-19831599)
chr7 (45-193)||(36436772-36436922)
chr7 (45-192)||(33027497-33027646)
chr7 (45-193)||(21375261-21375411)
chr7 (45-192)||(48831421-48831582)
chr7 (45-194)||(42375154-42375317)
chr7 (45-192)||(47586363-47586505)
chr7 (45-194)||(34709864-34710027)
chr7 (45-194)||(36245742-36245905)
chr7 (45-156)||(21254105-21254216)
chr7 (45-156)||(40636571-40636682)
chr7 (45-156)||(45686326-45686437)
chr7 (45-155)||(21745036-21745146)
chr7 (45-156)||(10311446-10311557)
chr7 (45-152)||(45221493-45221600)
chr7 (45-156)||(9488023-9488134)
chr7 (50-156)||(32169408-32169514)
chr7 (50-156)||(43254744-43254850)
chr7 (45-156)||(33203069-33203181)
chr7 (45-156)||(35588232-35588343)
chr7 (45-156)||(42586825-42586936)
chr7 (50-156)||(48814894-48815000)
chr7 (45-156)||(31511908-31512019)
chr7 (45-194)||(47470381-47470544)
chr7 (50-152)||(40259286-40259388)
chr7 (50-152)||(21313399-21313501)
chr7 (59-156)||(43135069-43135167)
chr7 (59-155)||(482388-482485)
chr7 (59-155)||(36407887-36407984)
chr7 (59-192)||(48730190-48730329)
chr7 (59-155)||(24171452-24171549)
chr7 (59-155)||(44597271-44597368)
chr7 (62-155)||(46878706-46878800)
chr7 (59-155)||(23030478-23030575)
chr7 (60-138)||(33608154-33608233)
chr7 (59-139)||(11780733-11780814)
chr7 (83-152)||(40894055-40894124)
chr7 (83-155)||(35001559-35001631)
chr7 (83-155)||(38530551-38530623)
chr7 (147-199)||(42586742-42586794)
chr7 (83-139)||(47584885-47584941)
chr7 (50-155)||(9486415-9486521)
chr7 (83-194)||(17845230-17845355)
chr7 (62-155)||(21739384-21739478)
chr7 (147-193)||(45221412-45221458)
chr7 (147-193)||(45686223-45686269)
chr7 (147-192)||(43254933-43254978)
chr7 (83-155)||(19756727-19756799)
chr7 (83-155)||(28424924-28424996)
chr7 (83-155)||(36610955-36611027)
chr7 (60-155)||(39699542-39699638)
chr7 (60-155)||(48621039-48621135)
chr7 (151-194)||(790607-790650)
chr7 (137-193)||(9488141-9488199)
chr7 (147-194)||(33203003-33203050)
chr7 (147-190)||(46878629-46878672)
chr7 (147-193)||(35588348-35588394)
chr7 (147-192)||(21254003-21254048)
chr7 (157-194)||(21745136-21745173)
chr7 (149-194)||(43135200-43135245)
chr7 (147-192)||(44597407-44597452)
chr7 (83-152)||(49148888-49148957)
chr7 (83-155)||(1344123-1344195)
chr7 (50-137)||(7884089-7884177)
chr7 (147-193)||(23030609-23030655)
chr7 (147-197)||(27655045-27655095)
chr7 (83-149)||(45673001-45673067)
chr7 (83-152)||(11465465-11465533)
chr7 (147-192)||(21313319-21313364)
chr7 (158-191)||(21739318-21739351)
chr7 (83-152)||(27655111-27655179)
chr7 (69-130)||(27867106-27867167)
chr7 (147-192)||(40894175-40894220)
chr7 (147-187)||(45673128-45673168)
chr7 (84-139)||(11780897-11780952)
chr7 (64-139)||(18499658-18499733)
chr7 (151-194)||(19756625-19756668)
chr7 (88-155)||(34733277-34733344)
chr7 (157-192)||(40636521-40636556)
chr7 (83-154)||(44745355-44745426)
chr7 (147-190)||(47585163-47585206)
chr7 (146-192)||(22641010-22641056)
chr7 (87-137)||(22641128-22641178)
chr7 (59-116)||(34351390-34351448)
chr7 (151-188)||(1344226-1344263)
chr7 (83-132)||(7909030-7909079)
chr7 (157-194)||(10311394-10311431)
chr7 (152-193)||(28424816-28424857)
chr7 (137-187)||(36407992-36408044)
chr7 (157-190)||(36610871-36610904)
chr7 (83-115)||(11780828-11780860)
chr7 (83-151)||(14101084-14101152)
chr7 (83-151)||(14411101-14411169)
chr7 (157-193)||(31512034-31512070)
[»] chr4 (158 HSPs)
chr4 (45-192)||(47416882-47417031)
chr4 (45-191)||(4354962-4355108)
chr4 (45-192)||(23867249-23867398)
chr4 (45-194)||(21370451-21370614)
chr4 (45-194)||(35821624-35821775)
chr4 (45-193)||(3010336-3010486)
chr4 (45-190)||(19513255-19513402)
chr4 (45-189)||(35468639-35468778)
chr4 (45-156)||(4392132-4392243)
chr4 (45-156)||(27185046-27185157)
chr4 (45-156)||(27397176-27397287)
chr4 (45-156)||(33004523-33004634)
chr4 (45-156)||(43225127-43225238)
chr4 (45-156)||(55495293-55495404)
chr4 (45-192)||(18583475-18583636)
chr4 (45-155)||(25439880-25439990)
chr4 (45-192)||(53407805-53407966)
chr4 (55-197)||(31679511-31679667)
chr4 (45-190)||(33116715-33116874)
chr4 (45-156)||(4938798-4938909)
chr4 (45-193)||(8942525-8942687)
chr4 (45-156)||(11151342-11151453)
chr4 (45-152)||(11601296-11601403)
chr4 (45-156)||(12233386-12233497)
chr4 (45-156)||(28307822-28307933)
chr4 (45-156)||(35776805-35776916)
chr4 (45-156)||(36007436-36007547)
chr4 (45-156)||(45780170-45780281)
chr4 (45-156)||(46895897-46896008)
chr4 (45-156)||(53275322-53275433)
chr4 (45-155)||(9031408-9031518)
chr4 (45-155)||(42117516-42117626)
chr4 (45-156)||(4516564-4516676)
chr4 (45-193)||(7707022-7707185)
chr4 (45-194)||(37114635-37114798)
chr4 (45-152)||(9043037-9043144)
chr4 (45-156)||(39086970-39087081)
chr4 (45-192)||(29414149-29414309)
chr4 (45-155)||(51010484-51010594)
chr4 (45-156)||(8829214-8829325)
chr4 (45-156)||(22037759-22037870)
chr4 (45-156)||(29664547-29664658)
chr4 (45-156)||(56373068-56373179)
chr4 (50-156)||(25198716-25198822)
chr4 (45-192)||(26827145-26827306)
chr4 (45-156)||(52670620-52670735)
chr4 (50-155)||(42123895-42124000)
chr4 (45-156)||(55855946-55856058)
chr4 (50-156)||(55357933-55358039)
chr4 (50-156)||(15636387-15636493)
chr4 (50-155)||(31953686-31953790)
chr4 (45-118)||(45906704-45906777)
chr4 (59-155)||(52714145-52714245)
chr4 (59-193)||(55765216-55765345)
chr4 (50-155)||(4464852-4464958)
chr4 (59-155)||(35580343-35580440)
chr4 (59-155)||(37832593-37832689)
chr4 (55-118)||(45906802-45906865)
chr4 (62-151)||(3919168-3919258)
chr4 (62-152)||(3930080-3930171)
chr4 (59-155)||(22893181-22893278)
chr4 (59-155)||(22944849-22944946)
chr4 (59-155)||(37970950-37971047)
chr4 (59-155)||(56269484-56269581)
chr4 (83-155)||(31435670-31435742)
chr4 (50-128)||(41863514-41863593)
chr4 (50-155)||(33509993-33510099)
chr4 (59-152)||(40496863-40496957)
chr4 (83-155)||(17716350-17716422)
chr4 (60-155)||(43077546-43077642)
chr4 (59-193)||(55829642-55829772)
chr4 (62-155)||(25236188-25236282)
chr4 (59-155)||(11051003-11051100)
chr4 (148-192)||(4938696-4938740)
chr4 (83-155)||(22431463-22431535)
chr4 (60-155)||(29627644-29627740)
chr4 (148-192)||(33004421-33004465)
chr4 (83-155)||(49551652-49551724)
chr4 (147-194)||(11151264-11151311)
chr4 (61-155)||(44433175-44433270)
chr4 (62-155)||(4390884-4390978)
chr4 (147-193)||(4392067-4392113)
chr4 (146-192)||(11601437-11601483)
chr4 (147-193)||(22037694-22037740)
chr4 (83-137)||(26443971-26444025)
chr4 (147-193)||(27184969-27185015)
chr4 (60-157)||(40120523-40120621)
chr4 (147-193)||(43225062-43225108)
chr4 (147-193)||(56373210-56373256)
chr4 (147-192)||(27397100-27397145)
chr4 (59-155)||(34033429-34033526)
chr4 (147-192)||(45906900-45906945)
chr4 (147-192)||(46896039-46896084)
chr4 (83-155)||(30365483-30365555)
chr4 (60-155)||(35842184-35842280)
chr4 (60-155)||(36485758-36485854)
chr4 (83-155)||(37047682-37047754)
chr4 (59-137)||(2187725-2187804)
chr4 (147-194)||(5460077-5460124)
chr4 (147-194)||(8829136-8829183)
chr4 (147-194)||(45780104-45780151)
chr4 (147-194)||(56269412-56269459)
chr4 (147-193)||(4390776-4390822)
chr4 (147-193)||(22431555-22431601)
chr4 (147-193)||(37832730-37832776)
chr4 (147-193)||(40496773-40496819)
chr4 (83-149)||(42085136-42085202)
chr4 (83-155)||(50503177-50503246)
chr4 (147-189)||(50503273-50503315)
chr4 (151-193)||(52707569-52707611)
chr4 (89-155)||(55685615-55685681)
chr4 (86-155)||(29060996-29061065)
chr4 (147-192)||(29627565-29627610)
chr4 (86-155)||(30561499-30561568)
chr4 (147-192)||(37971067-37971112)
chr4 (147-192)||(55495217-55495262)
chr4 (83-155)||(5460144-5460215)
chr4 (95-155)||(15015264-15015324)
chr4 (83-155)||(20148180-20148252)
chr4 (150-190)||(28307955-28307995)
chr4 (83-155)||(35190022-35190094)
chr4 (83-155)||(43326602-43326674)
chr4 (91-155)||(53224947-53225011)
chr4 (146-193)||(4464757-4464804)
chr4 (92-139)||(8716088-8716135)
chr4 (151-190)||(30561429-30561468)
chr4 (157-192)||(42117616-42117651)
chr4 (50-132)||(56544996-56545079)
chr4 (147-193)||(9042956-9043002)
chr4 (154-192)||(25198666-25198704)
chr4 (147-193)||(35842132-35842178)
chr4 (147-193)||(45520188-45520234)
chr4 (147-193)||(49551744-49551790)
chr4 (148-193)||(15015359-15015404)
chr4 (147-192)||(15636498-15636543)
chr4 (59-139)||(33574489-33574570)
chr4 (147-191)||(12233311-12233355)
chr4 (83-151)||(36197509-36197577)
chr4 (157-193)||(39086919-39086955)
chr4 (84-151)||(16398346-16398412)
chr4 (159-190)||(16398453-16398484)
chr4 (100-155)||(30622756-30622810)
chr4 (158-189)||(41863378-41863409)
chr4 (147-194)||(48056094-48056141)
chr4 (62-155)||(37338523-37338617)
chr4 (146-192)||(55855849-55855895)
chr4 (157-194)||(4516512-4516549)
chr4 (147-192)||(17716456-17716501)
chr4 (147-192)||(20148066-20148111)
chr4 (83-112)||(24953650-24953679)
chr4 (137-187)||(36007377-36007429)
chr4 (147-192)||(37338644-37338689)
chr4 (157-190)||(44433286-44433319)
chr4 (89-137)||(6288394-6288442)
chr4 (111-155)||(23164189-23164233)
chr4 (151-191)||(43780144-43780184)
chr4 (153-185)||(53275444-53275476)
chr4 (83-155)||(56011418-56011490)
[»] chr2 (116 HSPs)
chr2 (45-194)||(17263118-17263269)
chr2 (45-194)||(9887617-9887780)
chr2 (45-194)||(18212739-18212890)
chr2 (45-193)||(3378020-3378170)
chr2 (45-192)||(38578374-38578524)
chr2 (45-156)||(8705953-8706064)
chr2 (45-193)||(8815835-8815997)
chr2 (45-156)||(16487506-16487617)
chr2 (45-156)||(36711940-36712051)
chr2 (45-193)||(37000117-37000279)
chr2 (45-193)||(37356797-37356959)
chr2 (45-156)||(41323384-41323495)
chr2 (45-156)||(43506988-43507099)
chr2 (45-155)||(2545806-2545916)
chr2 (45-191)||(18710802-18710962)
chr2 (45-156)||(4452931-4453042)
chr2 (45-156)||(21865868-21865979)
chr2 (45-156)||(28382081-28382192)
chr2 (45-156)||(43136233-43136344)
chr2 (45-155)||(9263732-9263842)
chr2 (45-156)||(2265551-2265662)
chr2 (45-156)||(5040392-5040503)
chr2 (45-151)||(4037763-4037869)
chr2 (50-156)||(8340416-8340522)
chr2 (45-192)||(13527267-13527428)
chr2 (45-156)||(10838979-10839090)
chr2 (50-152)||(15569793-15569895)
chr2 (45-149)||(39168378-39168482)
chr2 (45-156)||(650189-650300)
chr2 (45-156)||(13111151-13111262)
chr2 (45-155)||(31615802-31615912)
chr2 (59-155)||(13350685-13350781)
chr2 (50-193)||(10728765-10728903)
chr2 (50-156)||(6153069-6153175)
chr2 (50-149)||(4385116-4385215)
chr2 (45-127)||(40024378-40024460)
chr2 (59-155)||(6759998-6760095)
chr2 (59-155)||(7399718-7399814)
chr2 (59-193)||(23356304-23356440)
chr2 (59-149)||(43293355-43293445)
chr2 (59-155)||(38880168-38880265)
chr2 (50-152)||(40868763-40868866)
chr2 (61-155)||(44276402-44276497)
chr2 (59-155)||(41796136-41796233)
chr2 (70-139)||(38843463-38843533)
chr2 (59-155)||(2758550-2758644)
chr2 (59-112)||(10392274-10392327)
chr2 (45-156)||(24401512-24401608)
chr2 (62-155)||(37709202-37709295)
chr2 (83-139)||(2759509-2759565)
chr2 (83-155)||(7510810-7510882)
chr2 (60-155)||(26912231-26912327)
chr2 (83-154)||(4056570-4056641)
chr2 (147-194)||(28381977-28382024)
chr2 (147-194)||(41796069-41796116)
chr2 (147-194)||(43136401-43136448)
chr2 (147-193)||(8705836-8705882)
chr2 (147-193)||(10838902-10838948)
chr2 (147-193)||(21866010-21866056)
chr2 (147-192)||(4452855-4452900)
chr2 (149-194)||(5040536-5040581)
chr2 (83-152)||(10820116-10820185)
chr2 (147-192)||(36711838-36711883)
chr2 (137-194)||(16487624-16487683)
chr2 (83-155)||(34807355-34807427)
chr2 (137-193)||(2265486-2265544)
chr2 (147-194)||(6759912-6759959)
chr2 (59-137)||(44880443-44880522)
chr2 (147-193)||(24401447-24401493)
chr2 (147-193)||(41323552-41323598)
chr2 (147-193)||(43506897-43506943)
chr2 (151-192)||(7399618-7399659)
chr2 (139-193)||(8340531-8340587)
chr2 (147-192)||(15569944-15569989)
chr2 (147-192)||(38880084-38880129)
chr2 (62-135)||(39675873-39675946)
chr2 (157-193)||(2545751-2545787)
chr2 (147-191)||(4056704-4056748)
chr2 (83-155)||(5519438-5519510)
chr2 (60-155)||(8069950-8070046)
chr2 (137-194)||(44276512-44276571)
chr2 (61-155)||(2046532-2046627)
chr2 (157-192)||(8687727-8687762)
chr2 (137-193)||(9263666-9263724)
chr2 (147-194)||(31615709-31615756)
chr2 (62-135)||(599742-599816)
chr2 (151-193)||(34807472-34807514)
chr2 (147-193)||(38843596-38843642)
chr2 (147-192)||(24020646-24020691)
chr2 (149-190)||(26912391-26912432)
chr2 (83-148)||(32622092-32622157)
chr2 (147-191)||(7693476-7693520)
chr2 (60-151)||(9052474-9052566)
chr2 (153-189)||(10392174-10392210)
chr2 (83-155)||(15250682-15250754)
chr2 (50-116)||(27886787-27886855)
chr2 (158-193)||(5519358-5519393)
chr2 (147-190)||(7570565-7570608)
chr2 (146-193)||(9052362-9052409)
chr2 (147-194)||(13762544-13762591)
chr2 (92-139)||(26411406-26411453)
chr2 (151-194)||(43293475-43293518)
chr2 (67-132)||(12737930-12737996)
chr2 (147-193)||(15250822-15250868)
chr2 (151-192)||(21722042-21722084)
chr2 (83-137)||(24020561-24020615)
chr2 (147-193)||(39168512-39168558)
chr2 (159-193)||(40868692-40868726)
chr2 (147-192)||(7212693-7212738)
chr2 (159-192)||(39676000-39676033)
chr2 (83-139)||(6222030-6222086)
chr2 (83-155)||(6231589-6231660)
chr2 (59-118)||(7693331-7693391)
chr2 (148-192)||(7822887-7822931)
chr2 (86-134)||(7822994-7823042)
chr2 (157-189)||(12737824-12737856)
[»] chr6 (61 HSPs)
chr6 (45-194)||(10856759-10856910)
chr6 (45-194)||(1805719-1805882)
chr6 (45-193)||(12432024-12432186)
chr6 (45-156)||(32732386-32732497)
chr6 (45-156)||(34232324-34232435)
chr6 (45-192)||(6709047-6709208)
chr6 (45-191)||(31451303-31451463)
chr6 (45-193)||(558966-559128)
chr6 (45-156)||(14227004-14227115)
chr6 (45-156)||(28721191-28721302)
chr6 (45-156)||(31099427-31099538)
chr6 (45-194)||(34684370-34684533)
chr6 (45-156)||(2443053-2443164)
chr6 (45-156)||(20805625-20805736)
chr6 (45-167)||(12297938-12298060)
chr6 (45-151)||(34904548-34904654)
chr6 (47-156)||(30810607-30810716)
chr6 (50-155)||(5943629-5943734)
chr6 (59-155)||(7317000-7317097)
chr6 (50-155)||(11016265-11016371)
chr6 (59-155)||(2971384-2971480)
chr6 (50-149)||(28077100-28077200)
chr6 (59-155)||(27720038-27720135)
chr6 (83-157)||(12140259-12140333)
chr6 (50-155)||(20564090-20564196)
chr6 (50-155)||(31049915-31050021)
chr6 (59-155)||(3107301-3107397)
chr6 (60-155)||(29413397-29413493)
chr6 (147-194)||(28721113-28721160)
chr6 (147-193)||(2443195-2443241)
chr6 (147-193)||(27719941-27719987)
chr6 (146-192)||(34904681-34904727)
chr6 (60-152)||(3636299-3636392)
chr6 (59-155)||(5300997-5301094)
chr6 (60-128)||(13854446-13854515)
chr6 (83-155)||(15590560-15590633)
chr6 (147-192)||(34232222-34232267)
chr6 (83-151)||(21897396-21897464)
chr6 (147-194)||(7316928-7316975)
chr6 (151-193)||(22757026-22757068)
chr6 (59-116)||(23648894-23648952)
chr6 (83-155)||(7289977-7290050)
chr6 (86-139)||(29490018-29490071)
chr6 (147-192)||(32732554-32732599)
chr6 (59-155)||(34440338-34440435)
chr6 (60-155)||(1225973-1226068)
chr6 (83-151)||(23953948-23954016)
chr6 (138-190)||(30810545-30810599)
chr6 (147-192)||(7289870-7289915)
chr6 (147-192)||(12140154-12140199)
chr6 (147-192)||(14226928-14226973)
chr6 (147-194)||(28077232-28077279)
chr6 (147-193)||(2971535-2971581)
chr6 (147-193)||(3636230-3636276)
chr6 (147-193)||(29413331-29413377)
chr6 (89-139)||(30023620-30023670)
chr6 (151-192)||(5300925-5300966)
chr6 (91-152)||(22756924-22756985)
chr6 (83-155)||(23953297-23953368)
chr6 (147-195)||(29822315-29822363)
chr6 (147-191)||(34440483-34440527)
[»] scaffold1526 (1 HSPs)
scaffold1526 (45-193)||(1363-1513)
[»] scaffold0246 (1 HSPs)
scaffold0246 (45-192)||(7682-7843)
[»] scaffold0027 (2 HSPs)
scaffold0027 (45-156)||(41165-41276)
scaffold0027 (147-192)||(41063-41108)
[»] scaffold0122 (1 HSPs)
scaffold0122 (45-192)||(11783-11944)
[»] scaffold0002 (3 HSPs)
scaffold0002 (45-156)||(431891-432002)
scaffold0002 (150-194)||(432024-432068)
scaffold0002 (60-139)||(98520-98599)
[»] scaffold0362 (2 HSPs)
scaffold0362 (45-156)||(6028-6139)
scaffold0362 (147-194)||(6170-6217)
[»] scaffold0197 (4 HSPs)
scaffold0197 (45-156)||(28440-28551)
scaffold0197 (50-156)||(27668-27774)
scaffold0197 (147-194)||(28362-28409)
scaffold0197 (147-192)||(27592-27637)
[»] scaffold0016 (4 HSPs)
scaffold0016 (45-156)||(92985-93096)
scaffold0016 (147-193)||(92842-92888)
scaffold0016 (83-155)||(84952-85024)
scaffold0016 (159-189)||(85079-85109)
[»] scaffold0087 (1 HSPs)
scaffold0087 (45-156)||(45159-45269)
[»] scaffold0031 (2 HSPs)
scaffold0031 (45-156)||(129593-129704)
scaffold0031 (147-192)||(129503-129548)
[»] scaffold0009 (1 HSPs)
scaffold0009 (50-155)||(192688-192794)
[»] scaffold0349 (2 HSPs)
scaffold0349 (59-155)||(9460-9557)
scaffold0349 (147-193)||(9363-9409)
[»] scaffold0471 (2 HSPs)
scaffold0471 (86-156)||(2134-2203)
scaffold0471 (147-192)||(2058-2103)
[»] scaffold0173 (2 HSPs)
scaffold0173 (86-156)||(22296-22366)
scaffold0173 (151-192)||(22220-22261)
[»] scaffold0418 (2 HSPs)
scaffold0418 (59-152)||(5078-5172)
scaffold0418 (147-193)||(5216-5262)
[»] scaffold0041 (2 HSPs)
scaffold0041 (83-152)||(72160-72229)
scaffold0041 (147-192)||(72064-72109)
[»] scaffold0012 (2 HSPs)
scaffold0012 (60-155)||(98568-98664)
scaffold0012 (147-195)||(98719-98767)
[»] scaffold0011 (1 HSPs)
scaffold0011 (60-155)||(64578-64674)
[»] scaffold0116 (1 HSPs)
scaffold0116 (147-193)||(25665-25711)
[»] scaffold0633 (1 HSPs)
scaffold0633 (91-139)||(4919-4967)
[»] scaffold0343 (2 HSPs)
scaffold0343 (59-155)||(9900-9997)
scaffold0343 (147-185)||(10066-10104)
[»] scaffold0004 (1 HSPs)
scaffold0004 (58-139)||(237803-237884)
[»] scaffold0076 (1 HSPs)
scaffold0076 (59-131)||(11136-11209)


Alignment Details
Target: chr3 (Bit Score: 160; Significance: 2e-85; HSPs: 131)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 45 - 204
Target Start/End: Complemental strand, 38891514 - 38891355
Alignment:
45 attaatgatgtaatttttattatgaattaagaataccctttatgtcattttacatttatcagctagttgaaccgttatttttaccaaacacttcagctag 144  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38891514 attaatgatgtaatttttattatgaattaagaataccctttatgtcattttacatttatcagctagttgaaccgttatttttaccaaacacttcagctag 38891415  T
145 cttatcagctaacttatcagctatccgctatttttaccaaacagagccttgttctatttt 204  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38891414 cttatcagctaacttatcagctatccgctatttttaccaaacagagccttgttctatttt 38891355  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 134; E-Value: 6e-70
Query Start/End: Original strand, 45 - 194
Target Start/End: Complemental strand, 45344528 - 45344379
Alignment:
45 attaatgatgtaatttttattatgaattaagaataccctttatgtcattttacatttatcagctagttgaaccgttatttttaccaaacacttcagctag 144  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| || |||    
45344528 attaatgatataatttttattatgaattaagaataccctttatgtcattttacatttatcagctagttgaaccgctatttttaccaaacactttagttag 45344429  T
145 cttatcagctaacttatcagctatccgctatttttaccaaacagagcctt 194  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||    
45344428 cttatcagctaacttatcagctatccgctatttttaccaaacagagcctt 45344379  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 117; E-Value: 8e-60
Query Start/End: Original strand, 45 - 193
Target Start/End: Complemental strand, 40479553 - 40479405
Alignment:
45 attaatgatgtaatttttattatgaattaagaataccctttatgtcattttacatttatcagctagttgaaccgttatttttaccaaacacttcagctag 144  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||| ||||||||||| ||     
40479553 attaatgatataatttttattatgaattaagaataccctttatgtcattttacatttatcagctagttgaactgctatttttactaaacacttcagttaa 40479454  T
145 cttatcagctaacttatcagctatccgctatttttaccaaacagagcct 193  Q
    |||||||| || |||||||||||||||||||||||||||||||||||||    
40479453 cttatcagttagcttatcagctatccgctatttttaccaaacagagcct 40479405  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 47 - 192
Target Start/End: Complemental strand, 16126670 - 16126523
Alignment:
47 taatgatgtaatttttattatgaattaagaataccctttatgtcattttacatttatcagctagttgaaccgttatttttaccaaacacttcagctagct 146  Q
    ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||| |||||    
16126670 taatgatataatttttattatgaattaagaataccctttatgtcattttacatttatcagctagttgaaccgctatttttatcaaacacttcagttagct 16126571  T
147 tatcagct--aacttatcagctatccgctatttttaccaaacagagcc 192  Q
    ||||||||  ||  ||||||||||||||||||||||| ||||||||||    
16126570 tatcagctaaaagctatcagctatccgctatttttacgaaacagagcc 16126523  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 45 - 194
Target Start/End: Original strand, 26541555 - 26541701
Alignment:
45 attaatgatgtaatttttattatgaattaagaataccctttatgtcattttacatttatcagctagttgaaccgttatttttaccaaacacttcagctag 144  Q
    ||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||    
26541555 attaatgatataatttttattatgaattaagaataccatttatgtcattttacatttatcagctagttgaaccgctatttttaccaaacacttcagttag 26541654  T
145 cttatcagctaacttatcagctatccgctatttttaccaaacagagcctt 194  Q
    |||||||||     ||||||||||||||||||||||||||| ||||||||    
26541655 cttatcagc---gctatcagctatccgctatttttaccaaagagagcctt 26541701  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 45 - 194
Target Start/End: Complemental strand, 43739817 - 43739662
Alignment:
45 attaatgatgtaatttttattatgaattaagaataccctttatgtcattttacatttatcagctagttgaaccgttatttttaccaaacacttcagctag 144  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||    
43739817 attaatgatataatttttattatgaattaagaataccctttatgtcattttacatttatcagctagttgaaccgctatttttaccaaacacttcagttag 43739718  T
145 cttatcagct--aacttatc----agctatccgctatttttaccaaacagagcctt 194  Q
    ||||||||||  ||  ||||    ||||||||||||||||||||||||||||||||    
43739717 cttatcagctaaaagctatcagctagctatccgctatttttaccaaacagagcctt 43739662  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 107; E-Value: 8e-54
Query Start/End: Original strand, 45 - 192
Target Start/End: Original strand, 39470507 - 39470656
Alignment:
45 attaatgatgtaatttttattatgaattaagaataccctttatgtcattttacatttatcagctagttgaaccgttatttttaccaaacacttcagctag 144  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||| || |||    
39470507 attaatgatataatttttattatgaattaagaataccctttatgtcattttacatttatcagccagttgaaccgctatttttaccaaacactttagttag 39470606  T
145 cttatcagct--aacttatcagctatccgctatttttaccaaacagagcc 192  Q
    ||||||||||  ||  ||||| ||||||||||||||||||||||||||||    
39470607 cttatcagctaaaagctatcatctatccgctatttttaccaaacagagcc 39470656  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 45 - 187
Target Start/End: Original strand, 53779656 - 53779800
Alignment:
45 attaatgatgtaatttttattatgaattaagaataccctttatgtcattttacatttatcagctagttgaaccgttatttttaccaaacacttcagctag 144  Q
    ||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||    
53779656 attaatgatataatttttattatgaatgaagaataccctttatgtcattttacatttatcagctagttgaaccgctatttttaccaaacacttcagttag 53779755  T
145 cttatcagct--aacttatcagctatccgctatttttaccaaaca 187  Q
    |||||||| |  || |||||||||||||||| |||||||||||||    
53779756 cttatcagttaaaagttatcagctatccgctgtttttaccaaaca 53779800  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 45 - 155
Target Start/End: Complemental strand, 54671705 - 54671595
Alignment:
45 attaatgatgtaatttttattatgaattaagaataccctttatgtcattttacatttatcagctagttgaaccgttatttttaccaaacacttcagctag 144  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||    
54671705 attaatgatataatttttattatgaattaagaataccctttatgtcattttacatttatcagctagttgaaccgttatttttaccaaacacttcagttag 54671606  T
145 cttatcagcta 155  Q
    |||||||||||    
54671605 cttatcagcta 54671595  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 45 - 193
Target Start/End: Original strand, 8873488 - 8873645
Alignment:
45 attaatgatgtaatttttattatgaattaagaataccctttatgtcattttacatttatcagctagttgaaccgttatttttaccaaacacttcagctag 144  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| | |||    
8873488 attaatgatataatttttattatgaattaagaataccctttatgtcattttacatttatcagctagttgaaccgctatttttaccaaacacttcggttag 8873587  T
145 cttatcagctaa---ct------tatcagctatccgctatttttaccaaacagagcct 193  Q
    ||||||||||||   ||      || ||||||||||||||||||||||||||||||||    
8873588 cttatcagctaaaagctatcagctaacagctatccgctatttttaccaaacagagcct 8873645  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 45 - 194
Target Start/End: Complemental strand, 29717727 - 29717564
Alignment:
45 attaatgatgtaatttttattatgaattaagaataccctttatgtcattttacatttatcagctagttgaaccgttatttttaccaaacacttcagctag 144  Q
    ||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||    
29717727 attaatgatataatttttattatgaattaagaataccttttatgtcattttacatttatcagctagttgaaccgctatttttaccaaacacttcagttag 29717628  T
145 cttatcagctaa--------------cttatcagctatccgctatttttaccaaacagagcctt 194  Q
    ||||||||||||              ||||||||||||||||||||||||||||||||||||||    
29717627 cttatcagctaaaagctatcagctagcttatcagctatccgctatttttaccaaacagagcctt 29717564  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 45 - 194
Target Start/End: Original strand, 37088914 - 37089077
Alignment:
45 attaatgatgtaatttttattatgaattaagaataccctttatgtcattttacatttatcagctagttgaaccgttatttttaccaaacacttcagctag 144  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||| |||    
37088914 attaatgatataatttttattatgaattaagaataccctttatgtcattttacatttatcagctagttaaaccgctatttttaccaaacacttcagttag 37089013  T
145 cttatcagctaa--------------cttatcagctatccgctatttttaccaaacagagcctt 194  Q
    ||||||||||||              ||||||||||||||||||||||||||||||||||||||    
37089014 cttatcagctaaaagctatcagttagcttatcagctatccgctatttttaccaaacagagcctt 37089077  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 45 - 156
Target Start/End: Complemental strand, 29080806 - 29080695
Alignment:
45 attaatgatgtaatttttattatgaattaagaataccctttatgtcattttacatttatcagctagttgaaccgttatttttaccaaacacttcagctag 144  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||    
29080806 attaatgatataatttttattatgaattaagaataccctttatgtcattttacatttatcagctagttgaaccgctatttttaccaaacacttcagttag 29080707  T
145 cttatcagctaa 156  Q
    ||||||||||||    
29080706 cttatcagctaa 29080695  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 45 - 193
Target Start/End: Complemental strand, 37528246 - 37528084
Alignment:
45 attaatgatgtaatttttattatgaattaagaataccctttatgtcattttacatttatcagctagttgaaccgttatttttaccaaacacttcagctag 144  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||| |||    
37528246 attaatgatataatttttattatgaattaagaataccctttatgtcattttacatttatcagctagttgaaccactatttttaccaaacacttcagttag 37528147  T
145 cttatcagctaa--------------cttatcagctatccgctatttttaccaaacagagcct 193  Q
    ||||||||||||              |||||||||||||||||||||||||||||||||||||    
37528146 cttatcagctaaaagctatcagctagcttatcagctatccgctatttttaccaaacagagcct 37528084  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 45 - 156
Target Start/End: Complemental strand, 37713491 - 37713380
Alignment:
45 attaatgatgtaatttttattatgaattaagaataccctttatgtcattttacatttatcagctagttgaaccgttatttttaccaaacacttcagctag 144  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||    
37713491 attaatgatataatttttattatgaattaagaataccctttatgtcattttacatttatcagctagttgaaccgctatttttaccaaacacttcagttag 37713392  T
145 cttatcagctaa 156  Q
    ||||||||||||    
37713391 cttatcagctaa 37713380  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 45 - 156
Target Start/End: Original strand, 38186402 - 38186513
Alignment:
45 attaatgatgtaatttttattatgaattaagaataccctttatgtcattttacatttatcagctagttgaaccgttatttttaccaaacacttcagctag 144  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||    
38186402 attaatgatataatttttattatgaattaagaataccctttatgtcattttacatttatcagctagttgaaccgctatttttaccaaacacttcagttag 38186501  T
145 cttatcagctaa 156  Q
    ||||||||||||    
38186502 cttatcagctaa 38186513  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 45 - 156
Target Start/End: Complemental strand, 55227313 - 55227202
Alignment:
45 attaatgatgtaatttttattatgaattaagaataccctttatgtcattttacatttatcagctagttgaaccgttatttttaccaaacacttcagctag 144  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||    
55227313 attaatgatataatttttattatgaattaagaataccctttatgtcattttacatttatcagctagttgaaccgctatttttaccaaacacttcagttag 55227214  T
145 cttatcagctaa 156  Q
    ||||||||||||    
55227213 cttatcagctaa 55227202  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 45 - 155
Target Start/End: Complemental strand, 19947845 - 19947735
Alignment:
45 attaatgatgtaatttttattatgaattaagaataccctttatgtcattttacatttatcagctagttgaaccgttatttttaccaaacacttcagctag 144  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||    
19947845 attaatgatataatttttattatgaattaagaataccctttatgtcattttacatttatcagctagttgaaccgctatttttaccaaacacttcagttag 19947746  T
145 cttatcagcta 155  Q
    |||||||||||    
19947745 cttatcagcta 19947735  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 45 - 192
Target Start/End: Complemental strand, 44748353 - 44748204
Alignment:
45 attaatgatgtaatttttattatgaattaagaataccctttatgtcattttacatttatcagctagttgaaccgttatttttaccaaacacttcagctag 144  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||| ||||||||||||||||||||  ||     
44748353 attaatgatataatttttattatgaattaagaataccctttatgtcattttacatttatcagttagatgaaccgctatttttaccaaacacttcaattaa 44748254  T
145 cttatcagct--aacttatcagctatccgctatttttaccaaacagagcc 192  Q
    ||||||||||  ||  |||||||||||||||||||||| |||||||||||    
44748253 cttatcagctaaaagctatcagctatccgctatttttatcaaacagagcc 44748204  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 45 - 155
Target Start/End: Complemental strand, 50316638 - 50316528
Alignment:
45 attaatgatgtaatttttattatgaattaagaataccctttatgtcattttacatttatcagctagttgaaccgttatttttaccaaacacttcagctag 144  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||    
50316638 attaatgatataatttttattatgaattaagaataccctttatgtcattttacatttatcagctagttgaaccgctatttttaccaaacacttcagttag 50316539  T
145 cttatcagcta 155  Q
    |||||||||||    
50316538 cttatcagcta 50316528  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 45 - 193
Target Start/End: Complemental strand, 54541544 - 54541387
Alignment:
45 attaatgatgtaatttttattatgaattaagaataccctttatgtcattttacatttatcagctagttgaaccgttatttttaccaaacacttcagctag 144  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||    
54541544 attaatgatataatttttattatgaattaagaataccctttatgtcattttacatttatcagctagttgaaccgctatttttaccaaacacttcagttag 54541445  T
145 cttatcagc---------taacttatcagctatccgctatttttaccaaacagagcct 193  Q
     ||||||||         |||  ||||||||||||| |||||||||||||||||||||    
54541444 tttatcagctaaaagttataagctatcagctatccgttatttttaccaaacagagcct 54541387  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #22
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 45 - 156
Target Start/End: Original strand, 35500234 - 35500345
Alignment:
45 attaatgatgtaatttttattatgaattaagaataccctttatgtcattttacatttatcagctagttgaaccgttatttttaccaaacacttcagctag 144  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||  |||    
35500234 attaatgatataatttttattatgaattaagaataccctttatgtcattttacatttatcagctagttgaaccgctatttttaccaaacacttcaattag 35500333  T
145 cttatcagctaa 156  Q
    ||||||||||||    
35500334 cttatcagctaa 35500345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #23
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 45 - 156
Target Start/End: Complemental strand, 40562890 - 40562779
Alignment:
45 attaatgatgtaatttttattatgaattaagaataccctttatgtcattttacatttatcagctagttgaaccgttatttttaccaaacacttcagctag 144  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||| |||    
40562890 attaatgatataatttttattatgaattaagaataccctttatgtcattttacatttatcagctagttgaaccgctgtttttaccaaacacttcagttag 40562791  T
145 cttatcagctaa 156  Q
    ||||||||||||    
40562790 cttatcagctaa 40562779  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #24
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 45 - 155
Target Start/End: Original strand, 21707744 - 21707854
Alignment:
45 attaatgatgtaatttttattatgaattaagaataccctttatgtcattttacatttatcagctagttgaaccgttatttttaccaaacacttcagctag 144  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||| |||    
21707744 attaatgatataatttttattatgaattaagaataccctttatgtcattttacatttatcaactagttgaaccgctatttttaccaaacacttcagttag 21707843  T
145 cttatcagcta 155  Q
    |||||||||||    
21707844 cttatcagcta 21707854  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #25
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 45 - 155
Target Start/End: Complemental strand, 28676450 - 28676340
Alignment:
45 attaatgatgtaatttttattatgaattaagaataccctttatgtcattttacatttatcagctagttgaaccgttatttttaccaaacacttcagctag 144  Q
    ||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||    
28676450 attaaggatataatttttattatgaattaagaataccctttatgtcattttacatttatcagctagttgaaccgctatttttaccaaacacttcagttag 28676351  T
145 cttatcagcta 155  Q
    |||||||||||    
28676350 cttatcagcta 28676340  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #26
Raw Score: 92; E-Value: 7e-45
Query Start/End: Original strand, 45 - 156
Target Start/End: Original strand, 4240885 - 4240996
Alignment:
45 attaatgatgtaatttttattatgaattaagaataccctttatgtcattttacatttatcagctagttgaaccgttatttttaccaaacacttcagctag 144  Q
    ||||||||| |||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||    
4240885 attaatgatataatttttattatgaattaataataccatttatgtcattttacatttatcagctagttgaaccgctatttttaccaaacacttcagttag 4240984  T
145 cttatcagctaa 156  Q
    ||||||||||||    
4240985 cttatcagctaa 4240996  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #27
Raw Score: 92; E-Value: 7e-45
Query Start/End: Original strand, 45 - 156
Target Start/End: Original strand, 44846249 - 44846360
Alignment:
45 attaatgatgtaatttttattatgaattaagaataccctttatgtcattttacatttatcagctagttgaaccgttatttttaccaaacacttcagctag 144  Q
    ||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||| ||||||||||||||||||||| |||    
44846249 attaatgatataatttttattatgaattaagaataccctttatatcattttacatttatcagttagttgaaccgctatttttaccaaacacttcagttag 44846348  T
145 cttatcagctaa 156  Q
    ||||||||||||    
44846349 cttatcagctaa 44846360  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #28
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 45 - 155
Target Start/End: Original strand, 25571008 - 25571118
Alignment:
45 attaatgatgtaatttttattatgaattaagaataccctttatgtcattttacatttatcagctagttgaaccgttatttttaccaaacacttcagctag 144  Q
    ||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||    
25571008 attaatgatataatttttattatgaattaagaatatcctttatgtcattttacatttatcagctagttgaaccgctatttttaccaaacacttcagttag 25571107  T
145 cttatcagcta 155  Q
     ||||||||||    
25571108 tttatcagcta 25571118  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #29
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 50 - 156
Target Start/End: Original strand, 52795536 - 52795642
Alignment:
50 tgatgtaatttttattatgaattaagaataccctttatgtcattttacatttatcagctagttgaaccgttatttttaccaaacacttcagctagcttat 149  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||| ||||||||    
52795536 tgatataatttttattatgaattaagaataccctttatgtcattttacatttatcacctagttgaaccgctatttttaccaaacacttcagttagcttat 52795635  T
150 cagctaa 156  Q
    |||||||    
52795636 cagctaa 52795642  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #30
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 50 - 192
Target Start/End: Original strand, 30549185 - 30549329
Alignment:
50 tgatgtaatttttattatgaattaagaataccctttatgtcattttacatttatcagctagttgaaccgttatttttaccaaacacttcagctagcttat 149  Q
    |||| |||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||| ||||||||||||||||||||  ||  ||||    
30549185 tgatataatttttattatgaattaagaataccctttataacattttacatttatcagctagttgaaccgctatttttaccaaacacttcatttaatttat 30549284  T
150 cagct--aacttatcagctatccgctatttttaccaaacagagcc 192  Q
    |||||  ||  ||||||||||||||||||||||||||||| ||||    
30549285 cagctaaaagctatcagctatccgctatttttaccaaacaaagcc 30549329  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #31
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 50 - 192
Target Start/End: Original strand, 33392343 - 33392499
Alignment:
50 tgatgtaatttttattatgaattaagaataccctttatgtcattttacatttatcagctagttgaaccgttatttttaccaaacacttcagctagcttat 149  Q
    |||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||| ||||| ||||||||    
33392343 tgatataatttttattatgaattaagaatacccttcatgtcattttacatttatcagctagttgaaccgctatttttaccaaacatttcagttagcttat 33392442  T
150 cagctaa--------------cttatcagctatccgctatttttaccaaacagagcc 192  Q
    |||||||              ||||||||||||||||||||||||||||||||||||    
33392443 cagctaaaagctatctgctagcttatcagctatccgctatttttaccaaacagagcc 33392499  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #32
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 45 - 156
Target Start/End: Complemental strand, 47897124 - 47897013
Alignment:
45 attaatgatgtaatttttattatgaattaagaataccctttatgtcattttacatttatcagctagttgaaccgttatttttaccaaacacttcagctag 144  Q
    ||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||| |||    
47897124 attaatgatataatttttattatgaattaagaatatcctttatgtcattttacatttatcagctagttgaaccgctatttttaccaaacatttcagttag 47897025  T
145 cttatcagctaa 156  Q
    ||||||| ||||    
47897024 cttatcaactaa 47897013  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #33
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 45 - 156
Target Start/End: Complemental strand, 55304634 - 55304523
Alignment:
45 attaatgatgtaatttttattatgaattaagaataccctttatgtcattttacatttatcagctagttgaaccgttatttttaccaaacacttcagctag 144  Q
    ||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||| ||||||| |||    
55304634 attaatgatataatttttattatgaattaagaataccctttatgtaattttacatttatcagctagttgaaccgctatttttaccaaatacttcagttag 55304535  T
145 cttatcagctaa 156  Q
     |||||||||||    
55304534 tttatcagctaa 55304523  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #34
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 45 - 155
Target Start/End: Original strand, 43526364 - 43526474
Alignment:
45 attaatgatgtaatttttattatgaattaagaataccctttatgtcattttacatttatcagctagttgaaccgttatttttaccaaacacttcagctag 144  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||| ||||| |||    
43526364 attaatgatataatttttattatgaattaagaataccctttatgtcattttacatttatcagctagttgaaccgctatttttatcaaacatttcagttag 43526463  T
145 cttatcagcta 155  Q
     ||||||||||    
43526464 tttatcagcta 43526474  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #35
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 45 - 155
Target Start/End: Original strand, 50500397 - 50500507
Alignment:
45 attaatgatgtaatttttattatgaattaagaataccctttatgtcattttacatttatcagctagttgaaccgttatttttaccaaacacttcagctag 144  Q
    |||||| || ||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||| ||||||||||||||||||||| |||    
50500397 attaattatataatttttattatgaattaagaataccctttatatcattttacatttatcagctaattgaaccgctatttttaccaaacacttcagttag 50500496  T
145 cttatcagcta 155  Q
    |||||||||||    
50500497 cttatcagcta 50500507  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #36
Raw Score: 79; E-Value: 4e-37
Query Start/End: Original strand, 50 - 193
Target Start/End: Complemental strand, 49852759 - 49852615
Alignment:
50 tgatgtaatttttattatgaattaagaataccctttatgtcattttacatttatcagctagttgaaccgttatttttaccaaacacttcagctagcttat 149  Q
    |||| |||||||||||||||||||| |||||| |||||||||||||| ||||||||||||||||||||  |||||||| |||||||||||| || |||||    
49852759 tgatataatttttattatgaattaa-aataccatttatgtcattttatatttatcagctagttgaacctctatttttatcaaacacttcagttaacttat 49852661  T
150 cagct--aacttatcagctatccgctatttttaccaaacagagcct 193  Q
    ||| |  ||  |||||||||||||||||||||||||||| ||||||    
49852660 cagataaaagctatcagctatccgctatttttaccaaacggagcct 49852615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #37
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 50 - 152
Target Start/End: Complemental strand, 24536118 - 24536016
Alignment:
50 tgatgtaatttttattatgaattaagaataccctttatgtcattttacatttatcagctagttgaaccgttatttttaccaaacacttcagctagcttat 149  Q
    |||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||| ||||| ||| ||||    
24536118 tgatataattttttttatgaattaagaataccctttatgtcattttacatttatcagctagttgaactgctatttttaccaaacatttcagttagtttat 24536019  T
150 cag 152  Q
    |||    
24536018 cag 24536016  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #38
Raw Score: 73; E-Value: 1e-33
Query Start/End: Original strand, 45 - 156
Target Start/End: Original strand, 21604425 - 21604537
Alignment:
45 attaatgatgtaatttt-tattatgaattaagaataccctttatgtcattttacatttatcagctagttgaaccgttatttttaccaaacacttcagcta 143  Q
    ||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||| |||||| |||||||||||||||||| |  ||    
21604425 attaatgatataattttttattatgaattaagaataccctttatgtcattttacatttaacagctagtggaaccgctatttttaccaaacacttaaatta 21604524  T
144 gcttatcagctaa 156  Q
    ||||||| |||||    
21604525 gcttatcggctaa 21604537  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #39
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 45 - 156
Target Start/End: Original strand, 44545851 - 44545962
Alignment:
45 attaatgatgtaatttttattatgaattaagaataccctttatgtcattttacatttatcagctagttgaaccgttatttttaccaaacacttcagctag 144  Q
    ||||||||| ||||||||||||| |||||||||||  ||||||||||||||||||||||||||||||||||||| |||||||||  ||||||| || |||    
44545851 attaatgatataatttttattataaattaagaatattctttatgtcattttacatttatcagctagttgaaccgctatttttacttaacacttaagttag 44545950  T
145 cttatcagctaa 156  Q
    ||||||| ||||    
44545951 cttatcacctaa 44545962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #40
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 59 - 155
Target Start/End: Original strand, 2852522 - 2852618
Alignment:
59 ttttattatgaattaagaataccctttatgtcattttacatttatcagctagttgaaccgttatttttaccaaacacttcagctagcttatcagcta 155  Q
    ||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||| | || |||||||||||||||||| |||||||| |||||    
2852522 ttttattataaattaagaatgccctttatgtcattttacatttatcagctagttgaacagctagttttaccaaacacttcagttagcttataagcta 2852618  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #41
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 82 - 155
Target Start/End: Complemental strand, 2579491 - 2579418
Alignment:
82 ctttatgtcattttacatttatcagctagttgaaccgttatttttaccaaacacttcagctagcttatcagcta 155  Q
    ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||    
2579491 ctttatgtcattttacatttatcagctagttgaaccgctatttttaccaaacacttcagttagcttatcagcta 2579418  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #42
Raw Score: 62; E-Value: 5e-27
Query Start/End: Original strand, 59 - 155
Target Start/End: Complemental strand, 37712676 - 37712579
Alignment:
59 ttttattatgaattaagaatacccttt-atgtcattttacatttatcagctagttgaaccgttatttttaccaaacacttcagctagcttatcagcta 155  Q
    ||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||| || ||||||||||||||| | |||  ||||||||||    
37712676 ttttattatgaattaagaataccattttatgtcattttacatttatcagctagttgaaccgctagttttaccaaacactttaactaatttatcagcta 37712579  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #43
Raw Score: 62; E-Value: 5e-27
Query Start/End: Original strand, 59 - 155
Target Start/End: Original strand, 46972693 - 46972790
Alignment:
59 ttttattatgaattaagaatacccttt-atgtcattttacatttatcagctagttgaaccgttatttttaccaaacacttcagctagcttatcagcta 155  Q
    |||||| ||||||||| |||||||||| |||||||||||| ||||| |||||||||||||| || |||||||||||||||||| ||||||||||||||    
46972693 ttttataatgaattaaaaatacccttttatgtcattttacgtttataagctagttgaaccgctaattttaccaaacacttcagttagcttatcagcta 46972790  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #44
Raw Score: 62; E-Value: 5e-27
Query Start/End: Original strand, 50 - 155
Target Start/End: Original strand, 51003893 - 51003998
Alignment:
50 tgatgtaatttttattatgaattaagaataccctttatgtcattttacatttatcagctagttgaaccgttatttttaccaaacacttcagctagcttat 149  Q
    |||| |||||||||||||||||||| ||||| |||||| |||||||| |||||||||||| |||||||| |||||||| |||||| ||||| ||||||||    
51003893 tgatataatttttattatgaattaaaaatactctttatatcattttagatttatcagctaattgaaccgctatttttatcaaacatttcagttagcttat 51003992  T
150 cagcta 155  Q
     |||||    
51003993 aagcta 51003998  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #45
Raw Score: 62; E-Value: 5e-27
Query Start/End: Original strand, 59 - 155
Target Start/End: Complemental strand, 52165583 - 52165486
Alignment:
59 ttttattatgaattaagaatacccttt-atgtcattttacatttatcagctagttgaaccgttatttttaccaaacacttcagctagcttatcagcta 155  Q
    |||||| ||||||||| |||||||||| |||||||||||| ||||| |||||||||||||| || |||||||||||||||||| ||||||||||||||    
52165583 ttttataatgaattaaaaatacccttttatgtcattttacgtttataagctagttgaaccgctaattttaccaaacacttcagttagcttatcagcta 52165486  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #46
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 89 - 156
Target Start/End: Complemental strand, 46247250 - 46247183
Alignment:
89 tcattttacatttatcagctagttgaaccgttatttttaccaaacacttcagctagcttatcagctaa 156  Q
    |||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||    
46247250 tcattttacatttatcagctagttgaaccgctatttttaccaaacacttcagttagcttatcagctaa 46247183  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #47
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 59 - 155
Target Start/End: Complemental strand, 24627653 - 24627557
Alignment:
59 ttttattatgaattaagaataccctttatgtcattttacatttatcagctagttgaaccgttatttttaccaaacacttcagctagcttatcagcta 155  Q
    ||||||||| ||||||||||  |||||||||||||||| ||||||||||||||| ||| | || |||||||||||||||||| |||||||| |||||    
24627653 ttttattataaattaagaatgtcctttatgtcattttatatttatcagctagttaaacggctagttttaccaaacacttcagttagcttataagcta 24627557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #48
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 83 - 155
Target Start/End: Original strand, 20451114 - 20451186
Alignment:
83 tttatgtcattttacatttatcagctagttgaaccgttatttttaccaaacacttcagctagcttatcagcta 155  Q
    |||||||||||||||||||||||||||||||||||| || ||||||||||||||| |  ||||||||||||||    
20451114 tttatgtcattttacatttatcagctagttgaaccgctaattttaccaaacactttaattagcttatcagcta 20451186  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #49
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 72 - 155
Target Start/End: Original strand, 39720072 - 39720156
Alignment:
72 taagaatacccttt-atgtcattttacatttatcagctagttgaaccgttatttttaccaaacacttcagctagcttatcagcta 155  Q
    |||||||||||||| ||||||||||| ||||||||||||||||||||| || ||||||||||||||||  ||| |||||||||||    
39720072 taagaatacccttttatgtcattttatatttatcagctagttgaaccgctagttttaccaaacacttcgactaacttatcagcta 39720156  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #50
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 45 - 101
Target Start/End: Complemental strand, 46247451 - 46247395
Alignment:
45 attaatgatgtaatttttattatgaattaagaataccctttatgtcattttacattt 101  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
46247451 attaatgatataatttttattatgaattaagaataccctttatgtcattttacattt 46247395  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #51
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 62 - 155
Target Start/End: Original strand, 41519194 - 41519288
Alignment:
62 tattatgaattaagaatacccttt-atgtcattttacatttatcagctagttgaaccgttatttttaccaaacacttcagctagcttatcagcta 155  Q
    ||||||||||||| |||||| ||| |||||||||||||||||||||||||||||||||||  ||||| ||||||| |||  |||||||| |||||    
41519194 tattatgaattaataatacctttttatgtcattttacatttatcagctagttgaaccgttcattttatcaaacacctcaattagcttataagcta 41519288  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #52
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 91 - 148
Target Start/End: Original strand, 30865084 - 30865141
Alignment:
91 attttacatttatcagctagttgaaccgttatttttaccaaacacttcagctagctta 148  Q
    |||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||    
30865084 attttacatttatcagctagttgaaccgctatttttaccaaacacttcagttagctta 30865141  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #53
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 83 - 155
Target Start/End: Complemental strand, 32025722 - 32025650
Alignment:
83 tttatgtcattttacatttatcagctagttgaaccgttatttttaccaaacacttcagctagcttatcagcta 155  Q
    ||||||||||||||||||||| || ||||||||||  || ||||||||||||||||| |||||||||||||||    
32025722 tttatgtcattttacatttataagttagttgaaccactaattttaccaaacacttcaactagcttatcagcta 32025650  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #54
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 60 - 155
Target Start/End: Original strand, 35100867 - 35100963
Alignment:
60 tttattatgaattaagaatacccttt-atgtcattttacatttatcagctagttgaaccgttatttttaccaaacacttcagctagcttatcagcta 155  Q
    ||||||||||||||| |||| ||||| |||| ||||||||| ||||||||| |||||| | || |||||||||||||||||  ||||||||||||||    
35100867 tttattatgaattaaaaatatccttttatgtaattttacatctatcagctaattgaactgctaattttaccaaacacttcaaatagcttatcagcta 35100963  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #55
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 59 - 135
Target Start/End: Complemental strand, 46626932 - 46626856
Alignment:
59 ttttattatgaattaagaataccctttatgtcattttacatttatcagctagttgaaccgttatttttaccaaacac 135  Q
    ||||||||| ||||||||||  ||||||||||||||||||||||||||||| |||||| | || |||||||||||||    
46626932 ttttattataaattaagaatgtcctttatgtcattttacatttatcagctaattgaacagctagttttaccaaacac 46626856  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #56
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 83 - 155
Target Start/End: Complemental strand, 52594814 - 52594742
Alignment:
83 tttatgtcattttacatttatcagctagttgaaccgttatttttaccaaacacttcagctagcttatcagcta 155  Q
    |||||||||||||| |||||| ||  ||||||||||||| ||||||||||||||||| |||||||||||||||    
52594814 tttatgtcattttatatttataagtcagttgaaccgttaattttaccaaacacttcaactagcttatcagcta 52594742  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #57
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 59 - 193
Target Start/End: Original strand, 52858557 - 52858711
Alignment:
59 ttttattatgaattaagaatacccttt-atgtcattttacatttatcagctagttgaaccgttatttttaccaaacacttcagctagcttatc------- 150  Q
    |||||| ||||||||| |||||||||| |||||||||||| ||||| |||||||||||||| || ||||| |||||| ||||| |||||||||           
52858557 ttttataatgaattaaaaatacccttttatgtcattttacgtttataagctagttgaaccgctaattttatcaaacatttcagttagcttatcttatcag 52858656  T
151 ------------agctaacttatcagctatccgctatttttaccaaacagagcct 193  Q
                |||||||||||||||||||||||||||||||||||||||||||    
52858657 ctaaaagctatcagctaacttatcagctatccgctatttttaccaaacagagcct 52858711  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #58
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 50 - 137
Target Start/End: Complemental strand, 52867668 - 52867580
Alignment:
50 tgatgtaatttttattatgaattaagaatacccttt-atgtcattttacatttatcagctagttgaaccgttatttttaccaaacactt 137  Q
    |||| ||| ||||||||| ||||| || |||||||| ||| ||||||||||||||||||||||||||||| || |||||||||||||||    
52867668 tgatataaattttattattaattaggagtacccttttatggcattttacatttatcagctagttgaaccgctaattttaccaaacactt 52867580  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #59
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 70 - 139
Target Start/End: Original strand, 42218270 - 42218340
Alignment:
70 attaagaatacccttt-atgtcattttacatttatcagctagttgaaccgttatttttaccaaacacttca 139  Q
    ||||| |||||||||| ||||||||||||||||||||||||||| ||||| || |||||||||||||||||    
42218270 attaataatacccttttatgtcattttacatttatcagctagttcaaccgctaattttaccaaacacttca 42218340  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #60
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 147 - 191
Target Start/End: Original strand, 45369667 - 45369711
Alignment:
147 tatcagctaacttatcagctatccgctatttttaccaaacagagc 191  Q
    |||||||||||||||||||||||||||||||||||||||||||||    
45369667 tatcagctaacttatcagctatccgctatttttaccaaacagagc 45369711  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #61
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 60 - 155
Target Start/End: Complemental strand, 46318204 - 46318108
Alignment:
60 tttattatgaattaagaatacccttt-atgtcattttacatttatcagctagttgaaccgttatttttaccaaacacttcagctagcttatcagcta 155  Q
    ||||||||||||||| |||  ||||| |||| ||||||||||||||||||| |||||||| || |||||||||||| || |  ||||||||||||||    
46318204 tttattatgaattaaaaatgtccttttatgtaattttacatttatcagctaattgaaccgctaattttaccaaacattttaagtagcttatcagcta 46318108  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #62
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 60 - 155
Target Start/End: Original strand, 47175066 - 47175162
Alignment:
60 tttattatgaattaagaatacccttt-atgtcattttacatttatcagctagttgaaccgttatttttaccaaacacttcagctagcttatcagcta 155  Q
    ||||||||||||||| |||  ||||| |||| ||||||||| ||||||||| ||||| || || |||||||||||||||||  ||||||||||||||    
47175066 tttattatgaattaaaaatgtccttttatgtaattttacatctatcagctaattgaatcgctaattttaccaaacacttcaagtagcttatcagcta 47175162  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #63
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 83 - 155
Target Start/End: Original strand, 52226033 - 52226105
Alignment:
83 tttatgtcattttacatttatcagctagttgaaccgttatttttaccaaacacttcagctagcttatcagcta 155  Q
    ||||||| ||||||||| ||||||||| |||||||| || |||||||||||||||||  ||||||||||||||    
52226033 tttatgtaattttacatctatcagctaattgaaccgctaattttaccaaacacttcaagtagcttatcagcta 52226105  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #64
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 147 - 194
Target Start/End: Complemental strand, 2579386 - 2579339
Alignment:
147 tatcagctaacttatcagctatccgctatttttaccaaacagagcctt 194  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||    
2579386 tatcagctagcttatcagctatccgctatttttaccaaacagagcctt 2579339  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #65
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 50 - 149
Target Start/End: Complemental strand, 25599936 - 25599837
Alignment:
50 tgatgtaatttttattatgaattaagaataccctttatgtcattttacatttatcagctagttgaaccgttatttttaccaaacacttcagctagcttat 149  Q
    |||||| | |||||||| |||||||||||  ||||| |||| ||||| ||||||||| ||||| |||| ||| ||||| ||||||||||| |||||||||    
25599936 tgatgttaattttattaagaattaagaatgtcctttttgtctttttatatttatcagttagttaaaccattaattttatcaaacacttcaactagcttat 25599837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #66
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 147 - 194
Target Start/End: Original strand, 38186532 - 38186579
Alignment:
147 tatcagctaacttatcagctatccgctatttttaccaaacagagcctt 194  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||    
38186532 tatcagctagcttatcagctatccgctatttttaccaaacagagcctt 38186579  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #67
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 147 - 194
Target Start/End: Complemental strand, 40562722 - 40562675
Alignment:
147 tatcagctaacttatcagctatccgctatttttaccaaacagagcctt 194  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||    
40562722 tatcagctagcttatcagctatccgctatttttaccaaacagagcctt 40562675  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #68
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 147 - 194
Target Start/End: Complemental strand, 55227171 - 55227124
Alignment:
147 tatcagctaacttatcagctatccgctatttttaccaaacagagcctt 194  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||    
55227171 tatcagctagcttatcagctatccgctatttttaccaaacagagcctt 55227124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #69
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 147 - 193
Target Start/End: Complemental strand, 29080664 - 29080618
Alignment:
147 tatcagctaacttatcagctatccgctatttttaccaaacagagcct 193  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||    
29080664 tatcagctagcttatcagctatccgctatttttaccaaacagagcct 29080618  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #70
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 69 - 155
Target Start/End: Complemental strand, 33895510 - 33895424
Alignment:
69 aattaagaataccctttatgtcattttacatttatcagctagttgaaccgttatttttaccaaacacttcagctagcttatcagcta 155  Q
    ||||||||||||| |||||||||||||| |||||||| ||||| |||| | ||||||||||||| |||| |  || |||||||||||    
33895510 aattaagaataccttttatgtcattttatatttatcaactagtagaactgctatttttaccaaatactttaattaacttatcagcta 33895424  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #71
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 9 - 51
Target Start/End: Complemental strand, 38891351 - 38891309
Alignment:
9 ataatcgtattataggtccaaagtattctacactctattaatg 51  Q
    |||||||||||||||||||||||||||||||||||||||||||    
38891351 ataatcgtattataggtccaaagtattctacactctattaatg 38891309  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #72
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 147 - 193
Target Start/End: Original strand, 43526494 - 43526540
Alignment:
147 tatcagctaacttatcagctatccgctatttttaccaaacagagcct 193  Q
    ||||||||||||||||| |||||||||||||||||||||||||||||    
43526494 tatcagctaacttatcaactatccgctatttttaccaaacagagcct 43526540  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #73
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 59 - 151
Target Start/End: Complemental strand, 12063216 - 12063124
Alignment:
59 ttttattatgaattaagaatacccttt-atgtcattttacatttatcagctagttgaaccgttatttttaccaaacacttcagctagcttatca 151  Q
    |||||| ||||||||| ||||| |||| |||||||||||| ||||| |||||||||||||  || ||||| ||||||||||| |||||||||||    
12063216 ttttataatgaattaaaaatactcttttatgtcattttacgtttataagctagttgaacc-ctaattttatcaaacacttcaactagcttatca 12063124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #74
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 60 - 152
Target Start/End: Complemental strand, 51990294 - 51990201
Alignment:
60 tttattatgaattaagaatacccttt-atgtcattttacatttatcagctagttgaaccgttatttttaccaaacacttcagctagcttatcag 152  Q
    ||||||||||||||| |||| | ||| |||| ||||| ||| ||||||||| |||||||| || |||||||||||||||||  |||||||||||    
51990294 tttattatgaattaaaaatatctttttatgttattttgcatctatcagctaattgaaccgctaattttaccaaacacttcaagtagcttatcag 51990201  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #75
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 50 - 137
Target Start/End: Complemental strand, 2812785 - 2812697
Alignment:
50 tgatgtaatttttattatgaattaagaatacccttt-atgtcattttacatttatcagctagttgaaccgttatttttaccaaacactt 137  Q
    |||| ||| ||||| ||| ||||||||||  ||||| |||||||||||||||||| || ||||||||||| || |||||||||||||||    
2812785 tgatataaattttaatataaattaagaatgtccttttatgtcattttacatttattaggtagttgaaccgctaattttaccaaacactt 2812697  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #76
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 83 - 155
Target Start/End: Complemental strand, 30813711 - 30813639
Alignment:
83 tttatgtcattttacatttatcagctagttgaaccgttatttttaccaaacacttcagctagcttatcagcta 155  Q
    ||||||| ||||||||| ||||||||| ||||| || || |||||||||||||||||  ||||||||||||||    
30813711 tttatgtaattttacatctatcagctaattgaatcgctaattttaccaaacacttcaagtagcttatcagcta 30813639  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #77
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 60 - 155
Target Start/End: Complemental strand, 32982031 - 32981935
Alignment:
60 tttattatgaattaagaataccc-tttatgtcattttacatttatcagctagttgaaccgttatttttaccaaacacttcagctagcttatcagcta 155  Q
    ||||||||||||||| |||| || ||||||| ||||||||| ||||| ||| ||||| || || ||||| |||||||||||  ||||||||||||||    
32982031 tttattatgaattaaaaatatccgtttatgtaattttacatctatcaactaattgaatcgctaattttatcaaacacttcaagtagcttatcagcta 32981935  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #78
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 60 - 155
Target Start/End: Complemental strand, 40932426 - 40932330
Alignment:
60 tttattatgaattaagaatacccttt-atgtcattttacatttatcagctagttgaaccgttatttttaccaaacacttcagctagcttatcagcta 155  Q
    ||||||||||||||| |||  ||||| |||| ||||||||| |||  |||| |||||||| || |||||||||||||||||  ||||||||||||||    
40932426 tttattatgaattaaaaatgtccttttatgtaattttacatatatatgctaattgaaccgctaattttaccaaacacttcaagtagcttatcagcta 40932330  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #79
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 60 - 155
Target Start/End: Original strand, 41246935 - 41247031
Alignment:
60 tttattatgaattaagaatacccttt-atgtcattttacatttatcagctagttgaaccgttatttttaccaaacacttcagctagcttatcagcta 155  Q
    ||||||||||||||| |||  ||||| |||| ||||||||| ||||||||| |||||||  || ||||| |||||||||||  ||||||||||||||    
41246935 tttattatgaattaaaaatgtccttttatgtaattttacatctatcagctaattgaaccactaattttatcaaacacttcaagtagcttatcagcta 41247031  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #80
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 83 - 155
Target Start/End: Complemental strand, 42463531 - 42463459
Alignment:
83 tttatgtcattttacatttatcagctagttgaaccgttatttttaccaaacacttcagctagcttatcagcta 155  Q
    ||||||| ||||||||| |||||| || ||||||||||| |||||||||||||||||  ||||||| ||||||    
42463531 tttatgtaattttacatctatcagttaattgaaccgttaattttaccaaacacttcaagtagcttagcagcta 42463459  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #81
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 83 - 155
Target Start/End: Complemental strand, 45692811 - 45692739
Alignment:
83 tttatgtcattttacatttatcagctagttgaaccgttatttttaccaaacacttcagctagcttatcagcta 155  Q
    ||||||| ||||||||| ||||||||| ||||||||||| ||||||||| |||||||  ||| ||||||||||    
45692811 tttatgtaattttacatctatcagctaattgaaccgttaattttaccaatcacttcaaatagtttatcagcta 45692739  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #82
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 147 - 194
Target Start/End: Complemental strand, 19947703 - 19947656
Alignment:
147 tatcagctaacttatcagctatccgctatttttaccaaacagagcctt 194  Q
    ||||||||| |||||||| |||||||||||||||||||||||||||||    
19947703 tatcagctagcttatcagttatccgctatttttaccaaacagagcctt 19947656  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #83
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 59 - 134
Target Start/End: Complemental strand, 29202528 - 29202453
Alignment:
59 ttttattatgaattaagaataccctttatgtcattttacatttatcagctagttgaaccgttatttttaccaaaca 134  Q
    ||||||||||||||||  ||  | |||||||||||||||||||||||| |||||||| || || ||||||||||||    
29202528 ttttattatgaattaaagatgacttttatgtcattttacatttatcagttagttgaatcgctagttttaccaaaca 29202453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #84
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 147 - 190
Target Start/End: Original strand, 35500402 - 35500445
Alignment:
147 tatcagctaacttatcagctatccgctatttttaccaaacagag 190  Q
    ||||||||| ||||||||||||||||||||||||||||||||||    
35500402 tatcagctagcttatcagctatccgctatttttaccaaacagag 35500445  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #85
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 86 - 137
Target Start/End: Complemental strand, 44806399 - 44806348
Alignment:
86 atgtcattttacatttatcagctagttgaaccgttatttttaccaaacactt 137  Q
    |||||||||||||||||| ||||||||||||||||| |||||||||| ||||    
44806399 atgtcattttacatttataagctagttgaaccgttaattttaccaaatactt 44806348  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #86
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 147 - 194
Target Start/End: Complemental strand, 52594722 - 52594675