View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5_2_4 (Length: 544)

Name: J5_2_4
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5_2_4
J5_2_4
[»] chr2 (2 HSPs)
chr2 (163-544)||(38485698-38486079)
chr2 (1-168)||(38485535-38485702)
[»] chr4 (2 HSPs)
chr4 (2-165)||(30119928-30120091)
chr4 (273-533)||(30120099-30120359)


Alignment Details
Target: chr2 (Bit Score: 374; Significance: 0; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 374; E-Value: 0
Query Start/End: Original strand, 163 - 544
Target Start/End: Complemental strand, 38486079 - 38485698
Alignment:
163 attaatgcagttccatagtcatggcctttgaacaaacttactgtactgcttgcttcagaaaatgatgacttttgcgagttgataccgtctggaatatctt 262  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38486079 attaatgcagttccatagtcatggcctttgaacaaacttactgtactgcttgcttcagaaaatgatgacttttgcgagttgataccgtctggaatatctt 38485980  T
263 gattcgttggaacaagttcacgtgagccttctgtgatctctacttctgatgcagaatctagaaaagccaaaagcttgagggccttatagtagtacatcat 362  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38485979 gattcgttggaacaagttcacgtgagccttctgtgatctctacttctgatgcagaatctagaaaagccaaaagcttgagggccttatagtagtacatcat 38485880  T
363 tcctctaacagtccgcgatagtgtctggtctctataggatgcccatgacctcaattctcttagtttatctgtccatatctcacggtctttcatcatccct 462  Q
    |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     
38485879 tcctctaacagtccgcgatagtgtctggcctctataggatgcccatgacctcaattctcttagtttatctgtccatatctcacggtctttcatcatcccc 38485780  T
463 tctcgcctcattctctccataaaattcttccattcatcttcatatatagtctgcagatagtatagagttgatatcccatctt 544  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38485779 tctcgcctcattctctccataaaattcttccattcatcttcatatatagtctgcagatagtatagagttgatatcccatctt 38485698  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 164; E-Value: 2e-87
Query Start/End: Original strand, 1 - 168
Target Start/End: Complemental strand, 38485702 - 38485535
Alignment:
1 atcttcattcccagttctgagctgctctttactgtaaaccacttcttcactataataaggggttagaacactgaaagccctcattttctcaacttgagga 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
38485702 atcttcattcccagttctgagctgctctttactgtaaaccacttcttcactataataaggggttagaacactgaaagccatcattttctcaacttgagga 38485603  T
101 gcatggggcatcttcataaaaagtgagttactgaagaatgcaattctccgtctagcttctagattaat 168  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38485602 gcatggggcatcttcataaaaagtgagttactgaagaatgcaattctccgtctagcttctagattaat 38485535  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 88; Significance: 5e-42; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 88; E-Value: 5e-42
Query Start/End: Original strand, 2 - 165
Target Start/End: Complemental strand, 30120091 - 30119928
Alignment:
2 tcttcattcccagttctgagctgctctttactgtaaaccacttcttcactataataaggggttagaacactgaaagccctcattttctcaacttgaggag 101  Q
    ||||||||| |||| |||||||| ||||| ||||| |  ||||||||| | |||||||| ||||||||||||||||||  ||||||||||||||| ||||    
30120091 tcttcattctcagtcctgagctgttctttgctgtataatacttcttcattgtaataaggtgttagaacactgaaagccagcattttctcaacttggggag 30119992  T
102 catggggcatcttcataaaaagtgagttactgaagaatgcaattctccgtctagcttctagatt 165  Q
    |||||||||| ||||||||||||||||| |||||||| ||||| |||||||| || ||||||||    
30119991 catggggcatattcataaaaagtgagttgctgaagaaagcaatcctccgtctggcctctagatt 30119928  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 85; E-Value: 3e-40
Query Start/End: Original strand, 273 - 533
Target Start/End: Complemental strand, 30120359 - 30120099
Alignment:
273 aacaagttcacgtgagccttctgtgatctctacttctgatgcagaatctagaaaagccaaaagcttgagggccttatagtagtacatcattcctctaaca 372  Q
    |||||| || ||||||||||||   || || | ||||||||||||||| ||||| | ||| | ||||||||||  |||||| |||||||||||||||||     
30120359 aacaagctcgcgtgagccttctcgaatgtccatttctgatgcagaatccagaaatgtcaacatcttgagggcccgatagtaatacatcattcctctaact 30120260  T
373 gtccgcgatagtgtctggtctctataggatgcccatgacctcaattctcttagtttatctgtccatatctcacggtctttcatcatcccttctcgcctca 472  Q
    |||||||||||||| ||| |||  ||||| |||||   |||||| ||||| |||||||| ||||| |  |||| ||||||||||||||| || || | ||    
30120259 gtccgcgatagtgtttggcctcggtaggaagcccacagcctcaaatctctaagtttatcagtccacagatcactgtctttcatcatcccctcccgacgca 30120160  T
473 ttctctccataaaattcttccattcatcttcatatatagtctgcagatagtatagagttga 533  Q
    | ||||||| |||||||||||| ||||| ||||| |||||||||| |||||| || |||||    
30120159 tcctctccagaaaattcttccactcatcatcataaatagtctgcaaatagtacagggttga 30120099  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 309789 times since January 2019
Visitors: 444