View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5_2_41 (Length: 199)

Name: J5_2_41
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5_2_41
J5_2_41
[»] chr3 (1 HSPs)
chr3 (1-192)||(23216523-23216714)
[»] chr7 (1 HSPs)
chr7 (1-192)||(33865978-33866169)
[»] chr6 (1 HSPs)
chr6 (2-192)||(11075251-11075441)


Alignment Details
Target: chr3 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 192
Target Start/End: Complemental strand, 23216714 - 23216523
Alignment:
1 acaagtgacgaatccggagaagacaaagatggagaagattacgtttttattgtgtgcctcggcctttaaggaactgatttgcggttcttgctcaattcct 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
23216714 acaagtgacgaatccggagaagacaaagatggagaagattacgtttttattgtgtgcctcggcctttaaggaactgatttgcggttcttgctcaattcct 23216615  T
101 atcccattgattaatttcgtcagcttatgtcgttacatgttcaattcaccatgtgtttccggcaacagagttgttcttctcgacacacgcta 192  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
23216614 atcccattgattaatttcgtcagcttatgtcgttacatgttcaattcaccatgtgtttccggcaacagagttgttcttctcgacacacgcta 23216523  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 164; Significance: 7e-88; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 164; E-Value: 7e-88
Query Start/End: Original strand, 1 - 192
Target Start/End: Original strand, 33865978 - 33866169
Alignment:
1 acaagtgacgaatccggagaagacaaagatggagaagattacgtttttattgtgtgcctcggcctttaaggaactgatttgcggttcttgctcaattcct 100  Q
    |||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||| |||||||||||||||||||||| ||||||||||||||||    
33865978 acaagtgacgaatccggagaagacaaagatggagtagattacgtttttattgtgtacctcagcctttaaggaactgatttgcgattcttgctcaattcct 33866077  T
101 atcccattgattaatttcgtcagcttatgtcgttacatgttcaattcaccatgtgtttccggcaacagagttgttcttctcgacacacgcta 192  Q
    |||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||    
33866078 atcccattgattaatttcgtcagcttttgtcgttacatgctcaattcaccatgtgtttccggcaacagagttgttcttctcgacacatgcta 33866169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 2 - 192
Target Start/End: Original strand, 11075251 - 11075441
Alignment:
2 caagtgacgaatccggagaagacaaagatggagaagattacgtttttattgtgtgcctcggcctttaaggaactgatttgcggttcttgctcaattccta 101  Q
    ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||  |||||||||||||||||||||||| |||    
11075251 caagtgacgaatctggagaagacaaagatggagaagattacgtttttattgtgtgcctcagcctttaaggttctgatttgcggttcttgctcaatttcta 11075350  T
102 tcccattgattaatttcgtcagcttatgtcgttacatgttcaattcaccatgtgtttccggcaacagagttgttcttctcgacacacgcta 192  Q
    ||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||| |||||||||||||| |||||||    
11075351 tcccattgattaatttcgtcagcttttgtcgttacatgctcaattcaccatgtgtttccggcaacagaattgttcttctcgactcacgcta 11075441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 203687 times since January 2019
Visitors: 1517