View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5_2_51 (Length: 631)

Name: J5_2_51
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5_2_51
J5_2_51
[»] chr2 (9 HSPs)
chr2 (1-611)||(31624616-31625226)
chr2 (1-110)||(31605876-31605983)
chr2 (67-155)||(31609536-31609623)
chr2 (64-120)||(31614526-31614582)
chr2 (89-166)||(31619658-31619735)
chr2 (558-611)||(31619975-31620029)
chr2 (2-48)||(31609490-31609536)
chr2 (431-518)||(31614842-31614924)
chr2 (559-611)||(31615049-31615102)


Alignment Details
Target: chr2 (Bit Score: 582; Significance: 0; HSPs: 9)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 582; E-Value: 0
Query Start/End: Original strand, 1 - 611
Target Start/End: Original strand, 31624616 - 31625226
Alignment:
1 gttgaatcacttgaataatgggtttatagagaaagaagcatgttacaactaatgatgaaaagtactaaaacacgtaattagcgtttgaatgtcaactttg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31624616 gttgaatcacttgaataatgggtttatagagaaagaagcatgttacaactaatgatgaaaagtactaaaacacgtaattagcgtttgaatgtcaactttg 31624715  T
101 aacattttgatggtcaacctatgtgcttgattgaggatgaaaatcattgactaattatttttattttaacttattttatccttaaagaaaaaacagtata 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31624716 aacattttgatggtcaacctatgtgcttgattgaggatgaaaatcattgactaattatttttattttaacttattttatccttaaagaaaaaacagtata 31624815  T
201 acttattttgtgtcacaactcacaaatggagtctagaaattggattgcgcggttgactgattgatgatcgttggatcgagattctatgatctaaatttta 300  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
31624816 acttattttgtgtcacaactcacaaatggagtctagaaattggattgcgtggttgactgattgatgatcgttggatcgagattctatgatctaaatttta 31624915  T
301 actaaaaattgatgcccttnnnnnnncgaaattttaaatttgaaccgttcgacctcaatccaacaattataattatgttaactatgtaatatattaaatt 400  Q
    |||||||||||||||||||       |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31624916 actaaaaattgatgcccttaaaaaaacgaaattttaaatttgaatcgttcgacctcaatccaacaattataattatgttaactatgtaatatattaaatt 31625015  T
401 ttttaccaccgacacaatctggagcagtgatatttgttgagattttaaaggagtgtttataaagagattcaagattcaaactctctattttaatcggtta 500  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31625016 ttttaccaccgacacaatctggagcagtgatatttgttgagattttaaaggagtgtttataaagagattcaagattcaaactctctattttaatcggtta 31625115  T
501 atccttcccaatccaattagacattaacattttatctataaaaataatattataatgtatgcatagtcaactatgattccatattcgttggagaggaact 600  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31625116 atccttcccaatccaattagacattaacattttatctataaaaataatattataatgtatgcatagtcaactatgattccatattcgttggagaggaact 31625215  T
601 cggttggaatt 611  Q
    |||||||||||    
31625216 cggttggaatt 31625226  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 79; E-Value: 1e-36
Query Start/End: Original strand, 1 - 110
Target Start/End: Original strand, 31605876 - 31605983
Alignment:
1 gttgaatcacttgaataatgggtttatagagaaagaagcatgttacaactaatgatgaaaagtactaaaacacgtaattagcgtttgaatgtcaactttg 100  Q
    ||||||||||||||||  ||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |    
31605876 gttgaatcacttgaat--tggatttatatagaaagaagcatgttacaactaatgatgaaaagtactaaaacacgtaattagcgtttgaatgttaacttgg 31605973  T
101 aacattttga 110  Q
    |||| |||||    
31605974 aacactttga 31605983  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 65; E-Value: 3e-28
Query Start/End: Original strand, 67 - 155
Target Start/End: Original strand, 31609536 - 31609623
Alignment:
67 aaaacacgtaattagcgtttgaatgtcaactttgaacattttgatggtcaacctatgtgcttgattgaggatgaaaatcattgactaat 155  Q
    ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| | |||| || ||||||||||||||    
31609536 aaaacacgtaattagcgtttgaatgtcaactttgaacatttcgatggtcaacctatgtgcttgact-aggaagataatcattgactaat 31609623  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 64 - 120
Target Start/End: Original strand, 31614526 - 31614582
Alignment:
64 actaaaacacgtaattagcgtttgaatgtcaactttgaacattttgatggtcaacct 120  Q
    ||||||||||||||||||||||||||||||||||||||||| || ||||||||||||    
31614526 actaaaacacgtaattagcgtttgaatgtcaactttgaacacttcgatggtcaacct 31614582  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 89 - 166
Target Start/End: Original strand, 31619658 - 31619735
Alignment:
89 atgtcaactttgaacattttgatggtcaacctatgtgcttgattgaggatgaaaatcattgactaattatttttattt 166  Q
    |||||||||||||||| || |||||||||||||||||||||| |||| | || |||||| ||||||||||||| ||||    
31619658 atgtcaactttgaacacttcgatggtcaacctatgtgcttgactgagaaagataatcatcgactaattattttaattt 31619735  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 558 - 611
Target Start/End: Original strand, 31619975 - 31620029
Alignment:
558 tatgcatagtcaactatgattcca-tattcgttggagaggaactcggttggaatt 611  Q
    |||||||||||||||||||||||| |||||||||||| |||||||||||||||||    
31619975 tatgcatagtcaactatgattccaatattcgttggagtggaactcggttggaatt 31620029  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 2 - 48
Target Start/End: Original strand, 31609490 - 31609536
Alignment:
2 ttgaatcacttgaataatgggtttatagagaaagaagcatgttacaa 48  Q
    ||||||||||||||| |||| ||||||||||||||||||||||||||    
31609490 ttgaatcacttgaatgatggatttatagagaaagaagcatgttacaa 31609536  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 431 - 518
Target Start/End: Original strand, 31614842 - 31614924
Alignment:
431 tatttgttgagattttaaaggagtgtttataaagagattcaagattcaaactctctattttaatcggttaatccttcccaatccaatt 518  Q
    ||||||||||||| || |||||| |||   || ||||||||||||||||  | ||||||||||   ||||||||||||||||||||||    
31614842 tatttgttgagatgttgaaggagcgtt---aaggagattcaagattcaa--tttctattttaacaagttaatccttcccaatccaatt 31614924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 559 - 611
Target Start/End: Original strand, 31615049 - 31615102
Alignment:
559 atgcatagtcaactatgattccat-attcgttggagaggaactcggttggaatt 611  Q
    ||||||||||||| |||||||||  ||||||||| |||||| ||||||||||||    
31615049 atgcatagtcaacaatgattccaagattcgttggggaggaattcggttggaatt 31615102  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 311209 times since January 2019
Visitors: 444