View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5_2_54 (Length: 469)

Name: J5_2_54
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5_2_54
J5_2_54
[»] chr3 (2 HSPs)
chr3 (1-469)||(46793047-46793515)
chr3 (33-120)||(46785037-46785121)
[»] chr1 (2 HSPs)
chr1 (301-393)||(22119994-22120086)
chr1 (254-297)||(22120107-22120150)
[»] chr5 (1 HSPs)
chr5 (305-333)||(1655030-1655058)


Alignment Details
Target: chr3 (Bit Score: 448; Significance: 0; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 448; E-Value: 0
Query Start/End: Original strand, 1 - 469
Target Start/End: Complemental strand, 46793515 - 46793047
Alignment:
1 gcaatagcattgaagagcaatgttgaacacattttctttcatgaaaatgtcgttttacaaagaattgttcctccaaattctgttgattttctctttgatt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46793515 gcaatagcattgaagagcaatgttgaacacattttctttcatgaaaatgtcgttttacaaagaattgttcctccaaattctgttgattttctctttgatt 46793416  T
101 gctcttagttcccaaactcgttatcaaacaaagagtcattataattttgttgtgagtcctatcaattcgtgagaattacttaataccctatagcattact 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46793415 gctcttagttcccaaactcgttatcaaacaaagagtcattataattttgttgtgagtcctatcaattcgtgagaattacttaataccctatagcattact 46793316  T
201 agtaaaacattatgtagcatagtagcttccctcaaataaaaatgtagcatagcatgcaataaccctaattttcattttttaaaatatttccgcaaacctt 300  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46793315 agtaaaacattatgtagcatagtagcttccctcaaataaaaatgtagcatagcatgcaataaccctaattttcattttttaaaatatttccgcaaacctt 46793216  T
301 gccctttgagtggagagctagttctatgcggcannnnnnncaccttgaattgttgcatgaaaataactagtatgtaattgaaatacattagtatactttt 400  Q
    |||||||||||||||||||||||||||||||||       ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46793215 gccctttgagtggagagctagttctatgcggcatttttttcaccttgaattgttgcatgaaaataactagtatgtaattgaaatacattagtatactttt 46793116  T
401 tgtcacatatatacaatagtatcttaattaattagatcgtatattaacttattaattttgttgcacaat 469  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46793115 tgtcacatatatacaatagtatcttaattaattagatcgtatattaacttattaattttgttgcacaat 46793047  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 33 - 120
Target Start/End: Complemental strand, 46785121 - 46785037
Alignment:
33 tttctttcatgaaaatgtcgttttacaaagaattgttcctccaaattctgttgattttctctttgattgctcttagttcccaaactcg 120  Q
    ||||||||||||||||||||||||||||||||||||   |||||| | |||||||||  ||||| ||| |||||||||||||||||||    
46785121 tttctttcatgaaaatgtcgttttacaaagaattgt---tccaaactttgttgatttattctttcattactcttagttcccaaactcg 46785037  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 68; Significance: 3e-30; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 301 - 393
Target Start/End: Complemental strand, 22120086 - 22119994
Alignment:
301 gccctttgagtggagagctagttctatgcggcannnnnnncaccttgaattgttgcatgaaaataactagtatgtaattgaaatacattagta 393  Q
    ||||||||||||||| |||||||||||||||||       |||||||||||||||||||||||||||||||||||||||||||||||||||||    
22120086 gccctttgagtggagtgctagttctatgcggcatttttttcaccttgaattgttgcatgaaaataactagtatgtaattgaaatacattagta 22119994  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 254 - 297
Target Start/End: Complemental strand, 22120150 - 22120107
Alignment:
254 atgcaataaccctaattttcattttttaaaatatttccgcaaac 297  Q
    |||| ||||||||||||||||||||||||||| |||||| ||||    
22120150 atgccataaccctaattttcattttttaaaatgtttccgaaaac 22120107  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 29; Significance: 0.0000007; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 305 - 333
Target Start/End: Original strand, 1655030 - 1655058
Alignment:
305 tttgagtggagagctagttctatgcggca 333  Q
    |||||||||||||||||||||||||||||    
1655030 tttgagtggagagctagttctatgcggca 1655058  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 105862 times since January 2019
Visitors: 1319