View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5_2_58 (Length: 339)

Name: J5_2_58
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5_2_58
J5_2_58
[»] chr7 (2 HSPs)
chr7 (1-233)||(37188256-37188488)
chr7 (230-339)||(37188484-37188593)
[»] chr4 (8 HSPs)
chr4 (15-233)||(53492294-53492512)
chr4 (15-193)||(53498648-53498826)
chr4 (15-204)||(53494651-53494840)
chr4 (15-217)||(52590372-52590574)
chr4 (18-163)||(53489552-53489697)
chr4 (230-281)||(53492602-53492653)
chr4 (15-204)||(53501759-53501949)
chr4 (230-281)||(53498907-53498958)
[»] chr8 (2 HSPs)
chr8 (27-208)||(35016252-35016433)
chr8 (17-80)||(42990787-42990850)
[»] chr2 (2 HSPs)
chr2 (13-130)||(16941461-16941578)
chr2 (13-130)||(17012126-17012243)
[»] chr3 (2 HSPs)
chr3 (17-124)||(38214692-38214799)
chr3 (39-124)||(38218935-38219020)


Alignment Details
Target: chr7 (Bit Score: 229; Significance: 1e-126; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 233
Target Start/End: Complemental strand, 37188488 - 37188256
Alignment:
1 tatttgaatatgtgcttacataataggcagtgacggtgccagcagagttgccaggaacaagtttaagctgcatatcaattttgccaaaaaggtattcatt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37188488 tatttgaatatgtgcttacataataggcagtgacggtgccagcagagttgccaggaacaagtttaagctgcatatcaattttgccaaaaaggtattcatt 37188389  T
101 tttggattgaaaaccagagccagaggatttgccaagagacaaagtaagaagttggccattgttgagtattttagcacgtccatccccccatgttatatca 200  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37188388 tttggattgaaaaccagagccagaggatttgtcaagagacaaagtaagaagttggccattgttgagtattttagcacgtccatccccccatgttatatca 37188289  T
201 aagtcttgataaaaattgccagcagaggcaatt 233  Q
    |||||||||||||||||||||||||||||||||    
37188288 aagtcttgataaaaattgccagcagaggcaatt 37188256  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 230 - 339
Target Start/End: Complemental strand, 37188593 - 37188484
Alignment:
230 aattcaaagtcaatttcatcccatgcaccaccttttgatgatagctgaattaattgagcataaagattccaattagttaaaaatattataaagtaaaagg 329  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37188593 aattcaaagtcaatttcatcccatgcaccaccttttgatgatagctgaattaattgagcataaagattccaattagttaaaaatattataaagtaaaagg 37188494  T
330 atgaatattt 339  Q
    ||||||||||    
37188493 atgaatattt 37188484  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 171; Significance: 8e-92; HSPs: 8)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 171; E-Value: 8e-92
Query Start/End: Original strand, 15 - 233
Target Start/End: Complemental strand, 53492512 - 53492294
Alignment:
15 cttacataataggcagtgacggtgccagcagagttgccaggaacaagtttaagctgcatatcaattttgccaaaaaggtattcatttttggattgaaaac 114  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |    
53492512 cttacataataggcagtgacagtgccagcagagttgccaggaacaagtttaagttgcatatcaattttgccaaaaaggtattcatttttggattgaaagc 53492413  T
115 cagagccagaggatttgccaagagacaaagtaagaagttggccattgttgagtattttagcacgtccatccccccatgttatatcaaagtcttgataaaa 214  Q
    | || |||||||| ||  ||||||| | |||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
53492412 ctgaaccagaggacttatcaagagatagagtaagaagttggccactgttgagtattttagcacgaccatccccccatgttatatcaaagtcttgataaaa 53492313  T
215 attgccagcagaggcaatt 233  Q
    |||||||||||||||||||    
53492312 attgccagcagaggcaatt 53492294  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 15 - 193
Target Start/End: Complemental strand, 53498826 - 53498648
Alignment:
15 cttacataataggcagtgacggtgccagcagagttgccaggaacaagtttaagctgcatatcaattttgccaaaaaggtattcatttttggattgaaaac 114  Q
    |||||||||||||||||||| |||||||||||||| || |||||||| |||| ||||||||||||||||||||| | ||||||||||||||||||||| |    
53498826 cttacataataggcagtgacagtgccagcagagtttcctggaacaagcttaatctgcatatcaattttgccaaataagtattcatttttggattgaaagc 53498727  T
115 cagagccagaggatttgccaagagacaaagtaagaagttggccattgttgagtattttagcacgtccatccccccatgt 193  Q
    | || ||||||| |||| ||||||| | ||||||||| | | | |||||||||||||| ||||| ||||| ||||||||    
53498726 ctgaaccagaggctttgtcaagagatagagtaagaagattggcgttgttgagtattttggcacgaccatctccccatgt 53498648  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 15 - 204
Target Start/End: Complemental strand, 53494840 - 53494651
Alignment:
15 cttacataataggcagtgacggtgccagcagagttgccaggaacaagtttaagctgcatatcaattttgccaaaaaggtattcatttttggattgaaaac 114  Q
    |||||||| || |||||||| || || |||||||| ||||| ||||| || |||||||||||||| |||||||| || |||||||| ||||||||||| |    
53494840 cttacatagtaagcagtgaccgttcctgcagagtttccaggtacaagcttgagctgcatatcaatgttgccaaagagatattcattcttggattgaaatc 53494741  T
115 cagagccagaggatttgccaagagacaaagtaagaagttggccattgttgagtattttagcacgtccatccccccatgttatatcaaagt 204  Q
    |||| ||||||| |||| |||| || ||||| |||||||| || |||| |||||| || ||||| ||||| |||||||||||||||||||    
53494740 cagaaccagaggctttgtcaagggataaagtgagaagttgtccgttgtcgagtatcttggcacgaccatctccccatgttatatcaaagt 53494651  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 15 - 217
Target Start/End: Complemental strand, 52590574 - 52590372
Alignment:
15 cttacataataggcagtgacggtgccagcagagttgccaggaacaagtttaagctgcatatcaattttgccaaaaaggtattcatttttggattgaaaac 114  Q
    ||||||||||| |  ||||| |||||||||||||| || || ||||| || || ||||| |||||||| ||||| | ||| |||||||||||  |||| |    
52590574 cttacataatatgttgtgactgtgccagcagagttaccgggcacaagctttagttgcatgtcaatttttccaaacaagtactcatttttggaacgaaatc 52590475  T
115 cagagccagaggatttgccaagagacaaagtaagaagttggccattgttgagtattttagcacgtccatccccccatgttatatcaaagtcttgataaaa 214  Q
    |||||||||| | |||| | | |||||||||||||||||| || |||||||| |||||  |||| ||||| ||||||||||||||||||| ||||| |||    
52590474 cagagccagatgctttgtccaaagacaaagtaagaagttgtccgttgttgaggattttgccacgaccatcaccccatgttatatcaaagtattgattaaa 52590375  T
215 att 217  Q
    |||    
52590374 att 52590372  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 18 - 163
Target Start/End: Original strand, 53489552 - 53489697
Alignment:
18 acataataggcagtgacggtgccagcagagttgccaggaacaagtttaagctgcatatcaattttgccaaaaaggtattcatttttggattgaaaaccag 117  Q
    |||||||| |||||||| |||||||| || || ||||||||||||||||  ||||| ||||| || ||| |||| |||| ||| ||||||||||| ||||    
53489552 acataataagcagtgactgtgccagctgaatttccaggaacaagtttaatttgcatgtcaatctttccataaagatattgattattggattgaaagccag 53489651  T
118 agccagaggatttgccaagagacaaagtaagaagttggccattgtt 163  Q
    ||||||||| | |  | ||||||| ||||||||| || ||||||||    
53489652 agccagaggttctatctagagacagagtaagaagctgaccattgtt 53489697  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 230 - 281
Target Start/End: Complemental strand, 53492653 - 53492602
Alignment:
230 aattcaaagtcaatttcatcccatgcaccaccttttgatgatagctgaatta 281  Q
    ||||||||||||||||||||||||||||| ||||||||||| ||||||||||    
53492653 aattcaaagtcaatttcatcccatgcacctccttttgatgacagctgaatta 53492602  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 15 - 204
Target Start/End: Complemental strand, 53501949 - 53501759
Alignment:
15 cttacataataggcagtgacggtgccagcagagttgccaggaacaagtttaagctgcatatcaattttgccaaaa-aggtattcatttttggattgaaaa 113  Q
    ||||| ||||| |||||||| |||||||||||||| ||||| |||||||| || ||||||||||| || |||||| || || ||||| || ||||| ||     
53501949 cttacgtaatatgcagtgacagtgccagcagagtttccagggacaagtttgagttgcatatcaatcttcccaaaagagatactcattctttgattggaat 53501850  T
114 ccagagccagaggatttgccaagagacaaagtaagaagttggccattgttgagtattttagcacgtccatccccccatgttatatcaaagt 204  Q
    || || ||||| | |||| |||| || | ||| || |  |  |||||||| ||||| || || || ||||| |||||||||||||||||||    
53501849 cctgaaccagatgctttgtcaagtgatagagtgagtaactcaccattgtttagtatcttcgctcggccatctccccatgttatatcaaagt 53501759  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 230 - 281
Target Start/End: Complemental strand, 53498958 - 53498907
Alignment:
230 aattcaaagtcaatttcatcccatgcaccaccttttgatgatagctgaatta 281  Q
    |||||||||||||| |||||||||||||| ||||||||||| ||||||||||    
53498958 aattcaaagtcaatctcatcccatgcacctccttttgatgacagctgaatta 53498907  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 46; Significance: 3e-17; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 27 - 208
Target Start/End: Complemental strand, 35016433 - 35016252
Alignment:
27 gcagtgacggtgccagcagagttgccaggaacaagtttaagctgcatatcaattttgccaaaaaggtattcatttttggattgaaaaccagagccagagg 126  Q
    |||||||| ||||||||||||||||||| |||||| |||||||||||||||||| | ||||| ||||| ||  | || ||||  || ||||||||||||     
35016433 gcagtgacagtgccagcagagttgccagcaacaagcttaagctgcatatcaattctcccaaataggtactctctctttgatttgaagccagagccagaga 35016334  T
127 atttgccaagagacaaagtaagaagttggccattgttgagtattttagcacgtccatccccccatgttatatcaaagtcttg 208  Q
     |||| |||| || |  |  |||||||| |||   |||| ||| ||||||||   ||| |||||||||| ||||||||||||    
35016333 ctttgtcaagggaaagtgatagaagttgaccaccattgaatatcttagcacggttatcaccccatgttagatcaaagtcttg 35016252  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 17 - 80
Target Start/End: Complemental strand, 42990850 - 42990787
Alignment:
17 tacataataggcagtgacggtgccagcagagttgccaggaacaagtttaagctgcatatcaatt 80  Q
    |||||| || ||||||||||| ||||||||||| |||| ||| ||||| || ||||||||||||    
42990850 tacatagtaagcagtgacggttccagcagagtttccagcaaccagtttgagttgcatatcaatt 42990787  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 46; Significance: 3e-17; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 13 - 130
Target Start/End: Complemental strand, 16941578 - 16941461
Alignment:
13 tgcttacataataggcagtgacggtgccagcagagttgccaggaacaagtttaagctgcatatcaattttgccaaaaaggtattcatttttggattgaaa 112  Q
    |||||||||||||||| |||||  ||||||||||||| ||||  |||||||| || ||||| |||||||| ||||| | ||| |||| ||||||  ||||    
16941578 tgcttacataataggctgtgacaatgccagcagagttaccagctacaagtttgagttgcatgtcaattttcccaaacaagtactcatatttggaacgaaa 16941479  T
113 accagagccagaggattt 130  Q
     ||||||||||| |||||    
16941478 gccagagccagaagattt 16941461  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 13 - 130
Target Start/End: Complemental strand, 17012243 - 17012126
Alignment:
13 tgcttacataataggcagtgacggtgccagcagagttgccaggaacaagtttaagctgcatatcaattttgccaaaaaggtattcatttttggattgaaa 112  Q
    |||||||||||||||| |||||  ||||||||||||| ||||  |||||||| || ||||| |||||||| ||||| | ||| |||| ||||||  ||||    
17012243 tgcttacataataggctgtgacaatgccagcagagttaccagctacaagtttgagttgcatgtcaattttcccaaacaagtactcatatttggaacgaaa 17012144  T
113 accagagccagaggattt 130  Q
     ||||||||||| |||||    
17012143 gccagagccagaagattt 17012126  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 32; Significance: 0.000000008; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 17 - 124
Target Start/End: Original strand, 38214692 - 38214799
Alignment:
17 tacataataggcagtgacggtgccagcagagttgccaggaacaagtttaagctgcatatcaattttgccaaaaaggtattcatttttggattgaaaacca 116  Q
    |||||| || ||||| || || |||||||| || |||| |||||||||||| |||||||||||| | ||||| |  || || || |||||||| || |||    
38214692 tacatagtaagcagtaacagttccagcagaatttccagcaacaagtttaagttgcatatcaattctaccaaataaatactctttcttggattggaagcca 38214791  T
117 gagccaga 124  Q
    ||||||||    
38214792 gagccaga 38214799  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 39 - 124
Target Start/End: Original strand, 38218935 - 38219020
Alignment:
39 ccagcagagttgccaggaacaagtttaagctgcatatcaattttgccaaaaaggtattcatttttggattgaaaaccagagccaga 124  Q
    |||||||| || |||| |||||||||||| |||||||||||| | ||||| |  || || || |||||||| || |||||||||||    
38218935 ccagcagaatttccagcaacaagtttaagttgcatatcaattctaccaaataaatactctttcttggattggaagccagagccaga 38219020  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 105804 times since January 2019
Visitors: 1319