View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5_2_63 (Length: 642)

Name: J5_2_63
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5_2_63
J5_2_63
[»] chr2 (1 HSPs)
chr2 (1-527)||(3290850-3291375)
[»] chr8 (1 HSPs)
chr8 (145-207)||(12861350-12861412)
[»] scaffold0249 (1 HSPs)
scaffold0249 (351-407)||(21711-21765)


Alignment Details
Target: chr2 (Bit Score: 440; Significance: 0; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 440; E-Value: 0
Query Start/End: Original strand, 1 - 527
Target Start/End: Complemental strand, 3291375 - 3290850
Alignment:
1 aaaccaccctcataaattttctaatatgcacataatgtaaactaaaaagtaaaaactattgttttattcgtcggagnnnnnnnnnnnaccaagattaaga 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||           |||||||||||||    
3291375 aaaccaccctcataaattttctaatatgcacataatgtaaactaaaaagtaaaaactattgttttattcgtcggagtttttttttttaccaagattaaga 3291276  T
101 ttgataattttactctataacgccactcgttgaaacggttatcttgctgagttggtaaagatggagaatgaagtgatcgtaaaacttgaaaatgtagcta 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3291275 ttgataattttactctataacgccactcgttgaaacggttatcttgctgagttggtaaagatggagaatgaagtgatcgtaaaacttgaaaatgtagcta 3291176  T
201 ttgaacgctcagatcagtcgtattggataaatacaacatttgaaggcaaaagattatcaaatgaactcccttagacgggtctcggatcagtggcgtagcg 300  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3291175 ttgaacgctcagatcagtcgtattggataaatacaacatttgaaggcaaaagattatcaaatgaactcccttagacgggtctcggatcagtggcgtagcg 3291076  T
301 acaatatggtgagagtgttcaaatgaactctcttaactnnnnnnnnnnnntgcacatatacccctatttattttgcattttgaaccccttgaatttcttt 400  Q
    ||||||||||||||||||||||||||||||||||||||            ||||||||||||||||||||||||||||||||||||||||||||||||||    
3291075 acaatatggtgagagtgttcaaatgaactctcttaact-aaaaaaaaaaatgcacatatacccctatttattttgcattttgaaccccttgaatttcttt 3290977  T
401 tccaccattagcccaagaagttcaagaactcaaaattcaaactccctaggtcaaggttttggctatgccactagttcaaacccaaaacttttcgatctat 500  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3290976 tccaccattagcccaagaagttcaagaactcaaaattcaaactccctaggtcaaggttttggctatgccactagttcaaacccaaaacttttcgatctat 3290877  T
501 gatctgnctttttacnangggacttca 527  Q
    |||||| |||||||| | | |||||||    
3290876 gatctgtctttttactatgtgacttca 3290850  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 51; Significance: 7e-20; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 51; E-Value: 7e-20
Query Start/End: Original strand, 145 - 207
Target Start/End: Original strand, 12861350 - 12861412
Alignment:
145 tgctgagttggtaaagatggagaatgaagtgatcgtaaaacttgaaaatgtagctattgaacg 207  Q
    ||||||||||||||||||||| |||||||| ||||||||||||||||||| ||||||||||||    
12861350 tgctgagttggtaaagatggacaatgaagtaatcgtaaaacttgaaaatgaagctattgaacg 12861412  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0249 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: scaffold0249
Description:

Target: scaffold0249; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 351 - 407
Target Start/End: Complemental strand, 21765 - 21711
Alignment:
351 tgcacatatacccctatttattttgcattttgaaccccttgaatttcttttccacca 407  Q
    |||| |||||||||||| |||||| ||||||||||||  ||||||| ||||||||||    
21765 tgcaaatatacccctatatatttttcattttgaaccc--tgaattttttttccacca 21711  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 176083 times since January 2019
Visitors: 1578