View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5_2_72 (Length: 1002)

Name: J5_2_72
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5_2_72
J5_2_72
[»] chr7 (20 HSPs)
chr7 (1-328)||(28480160-28480487)
chr7 (323-663)||(28479484-28479823)
chr7 (688-835)||(28479850-28479997)
chr7 (887-1002)||(28480049-28480164)
chr7 (692-745)||(22777357-22777410)
chr7 (689-747)||(2916110-2916169)
chr7 (704-747)||(6384859-6384902)
chr7 (702-745)||(21050230-21050273)
chr7 (704-747)||(32896474-32896517)
chr7 (688-745)||(7872741-7872799)
chr7 (717-747)||(46551869-46551899)
chr7 (688-745)||(46987096-46987154)
chr7 (711-745)||(48527200-48527234)
chr7 (708-745)||(2391017-2391054)
chr7 (704-745)||(5458081-5458122)
chr7 (708-745)||(7262687-7262724)
chr7 (716-745)||(8227359-8227388)
chr7 (688-747)||(23815306-23815367)
chr7 (701-745)||(25246781-25246826)
chr7 (716-745)||(39926560-39926589)
[»] chr5 (15 HSPs)
chr5 (688-747)||(22498950-22499009)
chr5 (706-747)||(40445991-40446032)
chr5 (711-747)||(8545006-8545042)
chr5 (688-747)||(31159437-31159497)
chr5 (704-747)||(3389170-3389213)
chr5 (716-747)||(4432124-4432155)
chr5 (692-747)||(17046342-17046397)
chr5 (716-747)||(23118073-23118104)
chr5 (711-745)||(13409560-13409594)
chr5 (709-747)||(14124309-14124347)
chr5 (693-747)||(39914909-39914963)
chr5 (716-745)||(18147728-18147757)
chr5 (698-747)||(29178455-29178504)
chr5 (692-745)||(35412967-35413020)
chr5 (712-745)||(37339778-37339811)
[»] chr2 (23 HSPs)
chr2 (689-745)||(39761448-39761504)
chr2 (553-598)||(18945365-18945410)
chr2 (704-747)||(16204827-16204870)
chr2 (705-747)||(1238170-1238212)
chr2 (688-745)||(24393255-24393313)
chr2 (688-745)||(28771592-28771650)
chr2 (708-745)||(7262816-7262853)
chr2 (704-745)||(27934867-27934908)
chr2 (708-745)||(39068722-39068759)
chr2 (707-747)||(18324907-18324947)
chr2 (707-747)||(30929058-30929098)
chr2 (711-747)||(40967388-40967424)
chr2 (698-745)||(7302145-7302192)
chr2 (716-747)||(9982633-9982664)
chr2 (708-747)||(22359013-22359052)
chr2 (711-745)||(5980237-5980271)
chr2 (711-745)||(7413206-7413240)
chr2 (707-745)||(9459070-9459108)
chr2 (692-745)||(4589715-4589768)
chr2 (716-745)||(10332297-10332326)
chr2 (704-745)||(12619354-12619395)
chr2 (693-745)||(27244667-27244720)
chr2 (688-744)||(34903528-34903585)
[»] chr4 (21 HSPs)
chr4 (704-747)||(18635538-18635581)
chr4 (689-745)||(24785456-24785513)
chr4 (689-745)||(24822753-24822810)
chr4 (692-745)||(49949344-49949397)
chr4 (689-731)||(41346780-41346822)
chr4 (706-747)||(29910469-29910510)
chr4 (688-747)||(7371541-7371601)
chr4 (689-745)||(7922245-7922301)
chr4 (705-745)||(33900735-33900775)
chr4 (716-747)||(39842034-39842065)
chr4 (716-747)||(56096212-56096243)
chr4 (688-745)||(11144658-11144716)
chr4 (711-745)||(12439674-12439708)
chr4 (711-745)||(36203246-36203280)
chr4 (711-745)||(42756123-42756157)
chr4 (710-747)||(20131435-20131472)
chr4 (711-744)||(29808285-29808318)
chr4 (716-745)||(33413352-33413381)
chr4 (716-745)||(46434782-46434811)
chr4 (704-745)||(49308830-49308871)
chr4 (688-745)||(50442741-50442798)
[»] chr8 (10 HSPs)
chr8 (688-745)||(1244698-1244756)
chr8 (688-745)||(19488310-19488368)
chr8 (711-745)||(5179803-5179837)
chr8 (701-747)||(8837928-8837974)
chr8 (712-742)||(10256331-10256361)
chr8 (711-745)||(14258025-14258059)
chr8 (712-746)||(29851651-29851685)
chr8 (688-745)||(30623303-30623361)
chr8 (706-747)||(8442499-8442540)
chr8 (708-745)||(24696020-24696057)
[»] chr3 (21 HSPs)
chr3 (688-745)||(4216393-4216450)
chr3 (688-747)||(38573566-38573626)
chr3 (704-747)||(17588370-17588413)
chr3 (688-745)||(45096036-45096094)
chr3 (706-747)||(11574261-11574302)
chr3 (708-745)||(13992681-13992718)
chr3 (692-745)||(46469287-46469340)
chr3 (696-747)||(12976603-12976655)
chr3 (711-747)||(39100433-39100469)
chr3 (711-747)||(39869824-39869860)
chr3 (711-747)||(47377366-47377402)
chr3 (716-747)||(22462320-22462351)
chr3 (711-746)||(32753837-32753872)
chr3 (688-745)||(1149062-1149120)
chr3 (692-745)||(8113559-8113613)
chr3 (688-745)||(30200836-30200894)
chr3 (688-745)||(35191810-35191868)
chr3 (711-745)||(39822189-39822223)
chr3 (688-745)||(54230092-54230150)
chr3 (711-744)||(10513640-10513673)
chr3 (708-745)||(38869532-38869569)
[»] chr1 (14 HSPs)
chr1 (698-742)||(19533182-19533226)
chr1 (708-747)||(2884462-2884501)
chr1 (694-745)||(15764042-15764094)
chr1 (712-743)||(5031172-5031203)
chr1 (698-745)||(9374392-9374439)
chr1 (704-747)||(39949820-39949863)
chr1 (688-747)||(49875593-49875652)
chr1 (704-746)||(16033460-16033502)
chr1 (688-745)||(38448859-38448917)
chr1 (713-751)||(38923029-38923067)
chr1 (704-745)||(24236628-24236669)
chr1 (706-747)||(28039872-28039913)
chr1 (706-747)||(45773554-45773595)
chr1 (706-747)||(46334783-46334824)
[»] chr6 (16 HSPs)
chr6 (698-747)||(6610085-6610135)
chr6 (701-745)||(18256893-18256937)
chr6 (709-745)||(26522482-26522518)
chr6 (693-747)||(2445307-2445362)
chr6 (704-747)||(3373391-3373434)
chr6 (708-747)||(6864147-6864186)
chr6 (704-747)||(14169555-14169598)
chr6 (701-747)||(1769776-1769822)
chr6 (711-745)||(9923250-9923284)
chr6 (711-745)||(33824891-33824925)
chr6 (704-745)||(334150-334191)
chr6 (708-745)||(2692225-2692262)
chr6 (706-747)||(10278461-10278502)
chr6 (704-745)||(14918310-14918351)
chr6 (708-741)||(26303824-26303857)
chr6 (712-745)||(26521133-26521166)
[»] scaffold0045 (1 HSPs)
scaffold0045 (717-751)||(32787-32821)
[»] scaffold0016 (1 HSPs)
scaffold0016 (704-746)||(99046-99088)


Alignment Details
Target: chr7 (Bit Score: 307; Significance: 1e-172; HSPs: 20)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 307; E-Value: 1e-172
Query Start/End: Original strand, 1 - 328
Target Start/End: Original strand, 28480160 - 28480487
Alignment:
1 aatgatccttatgatgacaaaatgatcatgaagaagttgttccaccataatctcaaacttttgttggtcacggaaggaataaagggctgtagatactaca 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28480160 aatgatccttatgatgacaaaatgatcatgaagaagttgttccaccataatctcaaacttttgttggtcacggaaggaataaagggctgtagatactaca 28480259  T
101 ccaaggtttgatccataaacaaaaactttcgtgaatttttcccccacagttctcgcgcgccctttatttttctgaactttaaaatctgaatgtgtaaaaa 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28480260 ccaaggtttgatccataaacaaaaactttcgtgaatttttcccccacagttctcgcgcgccctttatttttctgaactttaaaatctgaatgtgtaaaaa 28480359  T
201 acatgcaacagaactttaaatgcnnnnnnnggaagcttgtaaattggtcatggttaatcctaaacaggtttttattgttgcacaggactttaaaggttgg 300  Q
    |||||||||||||||||||||||       ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28480360 acatgcaacagaactttaaatgctttttttggaagcttgtaaattggtcatggttaatcctaaacaggtttttattgttgcacaggactttaaaggttgg 28480459  T
301 gtttatggttttgaggtggaagcaattg 328  Q
    ||||||||||||||||||||||||||||    
28480460 gtttatggttttgaggtggaagcaattg 28480487  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 294; E-Value: 1e-164
Query Start/End: Original strand, 323 - 663
Target Start/End: Original strand, 28479484 - 28479823
Alignment:
323 caattgtagcttaaattgactataagctcaatattttaannnnnnnnnccataaagtatctaatgtcatgtaggccacaatatttcattatggttcagtt 422  Q
    |||||||||||||||||||||||||||||||||||||||         |||||||||||||||||||||| |||||||||||||||||||||||||||||    
28479484 caattgtagcttaaattgactataagctcaatattttaatttttttttccataaagtatctaatgtcatgcaggccacaatatttcattatggttcagtt 28479583  T
423 agcttaattaaggagccttctaggtcaactcacattgaagcaataaattatgccaaaatgtgtggtagtatactgtcttatgccccaaatttgacagtgc 522  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28479584 agcttaattaaggagccttctaggtcaactcacattgaagcaataaattatgccaaaatgtgtggtagtatactgtcttatgccccaaatttgacagtgc 28479683  T
523 cactatggccatccaccagaggctgctagggaaggcatcatgagtatttggaactatgcagaccttattaaggtaaatgttttgaatatttttgtcatat 622  Q
    |||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
28479684 cactatggccat-caacagaggctgctagggaaggcatcatgagtatttggaactatgcagacgttattaaggtaaatgttttgaatatttttgtcatat 28479782  T
623 gtgtgttgaaatacatagtcaatcaaagtgtaaattagacc 663  Q
    |||||||||||||||||||||||||||||||||||||||||    
28479783 gtgtgttgaaatacatagtcaatcaaagtgtaaattagacc 28479823  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 148; E-Value: 1e-77
Query Start/End: Original strand, 688 - 835
Target Start/End: Original strand, 28479850 - 28479997
Alignment:
688 gtgtccgggcttcgaacccagatcttgtatatattatgcattgtccttatcaactgagttgagtgggaccgtaaattagaccctctaaatatacaagtac 787  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28479850 gtgtccgggcttcgaacccagatcttgtatatattatgcattgtccttatcaactgagttgagtgggaccgtaaattagaccctctaaatatacaagtac 28479949  T
788 aatatcataaacatttcaaattgccttcctaaaaggaccattgatgcc 835  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||    
28479950 aatatcataaacatttcaaattgccttcctaaaaggaccattgatgcc 28479997  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 112; E-Value: 4e-56
Query Start/End: Original strand, 887 - 1002
Target Start/End: Original strand, 28480049 - 28480164
Alignment:
887 ctaattacacttatatatttttatggatgaaaataggtattaactctatctatgcatgtatactccaaactgcaggtaagtgtggaagaaattcgaattt 986  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
28480049 ctaattacacttatatatttttatggatgaaaataggtattaactctatctatgcatatatactccaaactgcaggtaagtgtggaagaaattcgaattt 28480148  T
987 tgactgaaggtaatga 1002  Q
    ||||||||||||||||    
28480149 tgactgaaggtaatga 28480164  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 692 - 745
Target Start/End: Original strand, 22777357 - 22777410
Alignment:
692 ccgggcttcgaacccagatcttgtatatattatgcattgtccttatcaactgag 745  Q
    ||||| ||||||||| || |||| ||||||||||||||||||||||||||||||    
22777357 ccgggattcgaaccccgaccttgcatatattatgcattgtccttatcaactgag 22777410  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 689 - 747
Target Start/End: Complemental strand, 2916169 - 2916110
Alignment:
689 tgtccgggcttcgaa-cccagatcttgtatatattatgcattgtccttatcaactgagtt 747  Q
    |||||||| |||||| |||||| |||| |||||||||||||||||| || ||||||||||    
2916169 tgtccggggttcgaatcccagaccttgcatatattatgcattgtccgtaccaactgagtt 2916110  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 704 - 747
Target Start/End: Complemental strand, 6384902 - 6384859
Alignment:
704 cccagatcttgtatatattatgcattgtccttatcaactgagtt 747  Q
    |||||| |||| |||||||||||||||||||||| |||||||||    
6384902 cccagaccttgcatatattatgcattgtccttattaactgagtt 6384859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 702 - 745
Target Start/End: Original strand, 21050230 - 21050273
Alignment:
702 aacccagatcttgtatatattatgcattgtccttatcaactgag 745  Q
    |||||||| |||| ||||||||||||||||||||| ||||||||    
21050230 aacccagaccttgcatatattatgcattgtccttaccaactgag 21050273  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 704 - 747
Target Start/End: Original strand, 32896474 - 32896517
Alignment:
704 cccagatcttgtatatattatgcattgtccttatcaactgagtt 747  Q
    |||| |||||||||||||||||||||||||||  ||||||||||    
32896474 cccaaatcttgtatatattatgcattgtccttcccaactgagtt 32896517  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 688 - 745
Target Start/End: Original strand, 7872741 - 7872799
Alignment:
688 gtgtccgggcttcgaaccc-agatcttgtatatattatgcattgtccttatcaactgag 745  Q
    |||||| || ||||||||| ||| |||| ||||||||||||||||||||| ||||||||    
7872741 gtgtcctgggttcgaaccccagaccttgcatatattatgcattgtccttaccaactgag 7872799  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 717 - 747
Target Start/End: Original strand, 46551869 - 46551899
Alignment:
717 tatattatgcattgtccttatcaactgagtt 747  Q
    |||||||||||||||||||||||||||||||    
46551869 tatattatgcattgtccttatcaactgagtt 46551899  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 688 - 745
Target Start/End: Complemental strand, 46987154 - 46987096
Alignment:
688 gtgtccgggcttcgaacccag-atcttgtatatattatgcattgtccttatcaactgag 745  Q
    ||||||||| ||||||||| | | |||| ||||||||||||||||||||| ||||||||    
46987154 gtgtccggggttcgaaccccggaccttgcatatattatgcattgtccttaccaactgag 46987096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 711 - 745
Target Start/End: Complemental strand, 48527234 - 48527200
Alignment:
711 cttgtatatattatgcattgtccttatcaactgag 745  Q
    |||| ||||||||||||||||||||||||||||||    
48527234 cttgcatatattatgcattgtccttatcaactgag 48527200  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 708 - 745
Target Start/End: Complemental strand, 2391054 - 2391017
Alignment:
708 gatcttgtatatattatgcattgtccttatcaactgag 745  Q
    |||||||||||||||||||||||| |||| ||||||||    
2391054 gatcttgtatatattatgcattgttcttaccaactgag 2391017  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 704 - 745
Target Start/End: Original strand, 5458081 - 5458122
Alignment:
704 cccagatcttgtatatattatgcattgtccttatcaactgag 745  Q
    |||||| |||| |||||||||||||||| |||||||||||||    
5458081 cccagaccttgcatatattatgcattgttcttatcaactgag 5458122  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 708 - 745
Target Start/End: Original strand, 7262687 - 7262724
Alignment:
708 gatcttgtatatattatgcattgtccttatcaactgag 745  Q
    |||||||||||||||||||||||| |||||||| ||||    
7262687 gatcttgtatatattatgcattgttcttatcaattgag 7262724  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 716 - 745
Target Start/End: Complemental strand, 8227388 - 8227359
Alignment:
716 atatattatgcattgtccttatcaactgag 745  Q
    ||||||||||||||||||||||||||||||    
8227388 atatattatgcattgtccttatcaactgag 8227359  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 688 - 747
Target Start/End: Original strand, 23815306 - 23815367
Alignment:
688 gtgtccgggcttcgaacccaga-tcttgtatatattat-gcattgtccttatcaactgagtt 747  Q
    |||| |||| |||||||||||| ||||| ||||||||| |||||||||||| ||||||||||    
23815306 gtgttcgggattcgaacccagaatcttgcatatattattgcattgtccttaccaactgagtt 23815367  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #19
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 701 - 745
Target Start/End: Complemental strand, 25246826 - 25246781
Alignment:
701 gaacccaga-tcttgtatatattatgcattgtccttatcaactgag 745  Q
    ||||||||| ||||| ||||||||||||||||| ||||||||||||    
25246826 gaacccagaatcttgcatatattatgcattgtctttatcaactgag 25246781  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #20
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 716 - 745
Target Start/End: Original strand, 39926560 - 39926589
Alignment:
716 atatattatgcattgtccttatcaactgag 745  Q
    ||||||||||||||||||||||||||||||    
39926560 atatattatgcattgtccttatcaactgag 39926589  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 44; Significance: 0.000000000000002; HSPs: 15)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 688 - 747
Target Start/End: Complemental strand, 22499009 - 22498950
Alignment:
688 gtgtccgggcttcgaacccagatcttgtatatattatgcattgtccttatcaactgagtt 747  Q
    ||||||||| |||||||||||| |||| ||||||||||||||||||||| ||||||||||    
22499009 gtgtccggggttcgaacccagaccttgcatatattatgcattgtccttaccaactgagtt 22498950  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 706 - 747
Target Start/End: Complemental strand, 40446032 - 40445991
Alignment:
706 cagatcttgtatatattatgcattgtccttatcaactgagtt 747  Q
    |||| |||| ||||||||||||||||||||||||||||||||    
40446032 cagaccttgcatatattatgcattgtccttatcaactgagtt 40445991  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 711 - 747
Target Start/End: Original strand, 8545006 - 8545042
Alignment:
711 cttgtatatattatgcattgtccttatcaactgagtt 747  Q
    |||| ||||||||||||||||||||||||||||||||    
8545006 cttgcatatattatgcattgtccttatcaactgagtt 8545042  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 688 - 747
Target Start/End: Complemental strand, 31159497 - 31159437
Alignment:
688 gtgtccgggcttcgaacccaga-tcttgtatatattatgcattgtccttatcaactgagtt 747  Q
    ||||||||| ||||||||| || ||||| |||||||||| |||||| ||||||||||||||    
31159497 gtgtccggggttcgaaccctgaatcttgcatatattatgtattgtctttatcaactgagtt 31159437  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 704 - 747
Target Start/End: Complemental strand, 3389213 - 3389170
Alignment:
704 cccagatcttgtatatattatgcattgtccttatcaactgagtt 747  Q
    ||||||||||| |||||||||||||||||| || ||||||||||    
3389213 cccagatcttgcatatattatgcattgtccataccaactgagtt 3389170  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 716 - 747
Target Start/End: Complemental strand, 4432155 - 4432124
Alignment:
716 atatattatgcattgtccttatcaactgagtt 747  Q
    ||||||||||||||||||||||||||||||||    
4432155 atatattatgcattgtccttatcaactgagtt 4432124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 692 - 747
Target Start/End: Complemental strand, 17046397 - 17046342
Alignment:
692 ccgggcttcgaacccagatcttgtatatattatgcattgtccttatcaactgagtt 747  Q
    ||||| ||||||| | ||||||| |||||||||||||||||| || ||||||||||    
17046397 ccgggattcgaactcggatcttgcatatattatgcattgtccataccaactgagtt 17046342  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 716 - 747
Target Start/End: Original strand, 23118073 - 23118104
Alignment:
716 atatattatgcattgtccttatcaactgagtt 747  Q
    ||||||||||||||||||||||||||||||||    
23118073 atatattatgcattgtccttatcaactgagtt 23118104  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 711 - 745
Target Start/End: Complemental strand, 13409594 - 13409560
Alignment:
711 cttgtatatattatgcattgtccttatcaactgag 745  Q
    ||||||||||||||||||||| |||||||||||||    
13409594 cttgtatatattatgcattgttcttatcaactgag 13409560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 709 - 747
Target Start/End: Complemental strand, 14124347 - 14124309
Alignment:
709 atcttgtatatattatgcattgtccttatcaactgagtt 747  Q
    |||||||||||||||||||||||||||| ||||| ||||    
14124347 atcttgtatatattatgcattgtccttaccaactaagtt 14124309  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 693 - 747
Target Start/End: Complemental strand, 39914963 - 39914909
Alignment:
693 cgggcttcgaacccagatcttgtatatattatgcattgtccttatcaactgagtt 747  Q
    |||| ||||||||| || |||| ||||||||||||||||||||| ||| ||||||    
39914963 cggggttcgaacccggaccttgcatatattatgcattgtccttaccaattgagtt 39914909  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 716 - 745
Target Start/End: Complemental strand, 18147757 - 18147728
Alignment:
716 atatattatgcattgtccttatcaactgag 745  Q
    ||||||||||||||||||||||||||||||    
18147757 atatattatgcattgtccttatcaactgag 18147728  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 698 - 747
Target Start/End: Complemental strand, 29178504 - 29178455
Alignment:
698 ttcgaacccagatcttgtatatattatgcattgtccttatcaactgagtt 747  Q
    ||||||| |||| ||||||||| ||||||||||||| || ||||||||||    
29178504 ttcgaacacagaccttgtatattttatgcattgtccataccaactgagtt 29178455  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 692 - 745
Target Start/End: Complemental strand, 35413020 - 35412967
Alignment:
692 ccgggcttcgaacccagatcttgtatatattatgcattgtccttatcaactgag 745  Q
    ||||| ||||||||| || |||| |||||||||||||||||| ||| |||||||    
35413020 ccggggttcgaacccggaccttgcatatattatgcattgtccatattaactgag 35412967  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 712 - 745
Target Start/End: Original strand, 37339778 - 37339811
Alignment:
712 ttgtatatattatgcattgtccttatcaactgag 745  Q
    ||||||||||||||||||||| ||||||||||||    
37339778 ttgtatatattatgcattgtctttatcaactgag 37339811  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 41; Significance: 0.0000000000001; HSPs: 23)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 689 - 745
Target Start/End: Complemental strand, 39761504 - 39761448
Alignment:
689 tgtccgggcttcgaacccagatcttgtatatattatgcattgtccttatcaactgag 745  Q
    |||||||| ||| |||||||| |||| ||||||||||||||||||||||||||||||    
39761504 tgtccggggttcaaacccagaccttgcatatattatgcattgtccttatcaactgag 39761448  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 553 - 598
Target Start/End: Original strand, 18945365 - 18945410
Alignment:
553 gaaggcatcatgagtatttggaactatgcagaccttattaaggtaa 598  Q
    |||| |||||||||||||||||||||||||||| ||||||||||||    
18945365 gaagacatcatgagtatttggaactatgcagacattattaaggtaa 18945410  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 36; E-Value: 0.00000000009
Query Start/End: Original strand, 704 - 747
Target Start/End: Original strand, 16204827 - 16204870
Alignment:
704 cccagatcttgtatatattatgcattgtccttatcaactgagtt 747  Q
    |||||| |||| ||||||||||||||||||||||||||||||||    
16204827 cccagaccttgcatatattatgcattgtccttatcaactgagtt 16204870  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 705 - 747
Target Start/End: Complemental strand, 1238212 - 1238170
Alignment:
705 ccagatcttgtatatattatgcattgtccttatcaactgagtt 747  Q
    ||||||||||||||||||||||||||||| |||||| ||||||    
1238212 ccagatcttgtatatattatgcattgtccctatcaattgagtt 1238170  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 688 - 745
Target Start/End: Complemental strand, 24393313 - 24393255
Alignment:
688 gtgtccgggcttcgaacc-cagatcttgtatatattatgcattgtccttatcaactgag 745  Q
    ||||||||| |||||||| |||| |||| ||||||||||||||||||||| ||||||||    
24393313 gtgtccggggttcgaacctcagaccttgcatatattatgcattgtccttaacaactgag 24393255  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 688 - 745
Target Start/End: Complemental strand, 28771650 - 28771592
Alignment:
688 gtgtccgggcttcgaacc-cagatcttgtatatattatgcattgtccttatcaactgag 745  Q
    ||||||||| |||||||| | ||||||| ||||||||||||||||||||| ||||||||    
28771650 gtgtccggggttcgaaccgcggatcttgcatatattatgcattgtccttaccaactgag 28771592  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 708 - 745
Target Start/End: Complemental strand, 7262853 - 7262816
Alignment:
708 gatcttgtatatattatgcattgtccttatcaactgag 745  Q
    |||||||||||||||||||||||||| |||||||||||    
7262853 gatcttgtatatattatgcattgtccatatcaactgag 7262816  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 704 - 745
Target Start/End: Original strand, 27934867 - 27934908
Alignment:
704 cccagatcttgtatatattatgcattgtccttatcaactgag 745  Q
    |||||||||||||||||||||| |||||||||| ||||||||    
27934867 cccagatcttgtatatattatgtattgtccttaccaactgag 27934908  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 708 - 745
Target Start/End: Original strand, 39068722 - 39068759
Alignment:
708 gatcttgtatatattatgcattgtccttatcaactgag 745  Q
    ||||||| ||||||||||||||||||||||||||||||    
39068722 gatcttgcatatattatgcattgtccttatcaactgag 39068759  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 707 - 747
Target Start/End: Original strand, 18324907 - 18324947
Alignment:
707 agatcttgtatatattatgcattgtccttatcaactgagtt 747  Q
    |||||||| ||||||||||||||||||||| ||||||||||    
18324907 agatcttgcatatattatgcattgtccttaccaactgagtt 18324947  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 707 - 747
Target Start/End: Original strand, 30929058 - 30929098
Alignment:
707 agatcttgtatatattatgcattgtccttatcaactgagtt 747  Q
    ||||||| ||||||||||||||||||| |||||||||||||    
30929058 agatcttatatatattatgcattgtccatatcaactgagtt 30929098  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 711 - 747
Target Start/End: Original strand, 40967388 - 40967424
Alignment:
711 cttgtatatattatgcattgtccttatcaactgagtt 747  Q
    |||| ||||||||||||||||||||||||||||||||    
40967388 cttgcatatattatgcattgtccttatcaactgagtt 40967424  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 698 - 745
Target Start/End: Original strand, 7302145 - 7302192
Alignment:
698 ttcgaacccagatcttgtatatattatgcattgtccttatcaactgag 745  Q
    |||||||||||| |||| |||| ||||||||||||| |||||||||||    
7302145 ttcgaacccagaccttgcatattttatgcattgtccctatcaactgag 7302192  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 716 - 747
Target Start/End: Complemental strand, 9982664 - 9982633
Alignment:
716 atatattatgcattgtccttatcaactgagtt 747  Q
    ||||||||||||||||||||||||||||||||    
9982664 atatattatgcattgtccttatcaactgagtt 9982633  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 708 - 747
Target Start/End: Complemental strand, 22359052 - 22359013
Alignment:
708 gatcttgtatatattatgcattgtccttatcaactgagtt 747  Q
    ||||||| ||||||||||||||||||||| ||||||||||    
22359052 gatcttgcatatattatgcattgtccttaccaactgagtt 22359013  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 711 - 745
Target Start/End: Complemental strand, 5980271 - 5980237
Alignment:
711 cttgtatatattatgcattgtccttatcaactgag 745  Q
    |||| ||||||||||||||||||||||||||||||    
5980271 cttgcatatattatgcattgtccttatcaactgag 5980237  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 711 - 745
Target Start/End: Original strand, 7413206 - 7413240
Alignment:
711 cttgtatatattatgcattgtccttatcaactgag 745  Q
    |||||||||||||||||||||||||| ||||||||    
7413206 cttgtatatattatgcattgtccttaccaactgag 7413240  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #18
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 707 - 745
Target Start/End: Original strand, 9459070 - 9459108
Alignment:
707 agatcttgtatatattatgcattgtccttatcaactgag 745  Q
    |||| ||||||||||||||||||||| ||||||||||||    
9459070 agattttgtatatattatgcattgtctttatcaactgag 9459108  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #19
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 692 - 745
Target Start/End: Original strand, 4589715 - 4589768
Alignment:
692 ccgggcttcgaacccagatcttgtatatattatgcattgtccttatcaactgag 745  Q
    ||||| ||||||||||||||||| ||||||||| |||||| | | |||||||||    
4589715 ccggggttcgaacccagatcttgcatatattatacattgttcatgtcaactgag 4589768  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #20
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 716 - 745
Target Start/End: Original strand, 10332297 - 10332326
Alignment:
716 atatattatgcattgtccttatcaactgag 745  Q
    ||||||||||||||||||||||||||||||    
10332297 atatattatgcattgtccttatcaactgag 10332326  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #21
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 704 - 745
Target Start/End: Complemental strand, 12619395 - 12619354
Alignment:
704 cccagatcttgtatatattatgcattgtccttatcaactgag 745  Q
    ||||||||||| |||||||||||||| || ||||||||||||    
12619395 cccagatcttgcatatattatgcattatcattatcaactgag 12619354  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #22
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 693 - 745
Target Start/End: Complemental strand, 27244720 - 27244667
Alignment:
693 cgggcttcgaaccc-agatcttgtatatattatgcattgtccttatcaactgag 745  Q
    ||||||| |||||| ||| |||| |||||||||||||||||| |||||||||||    
27244720 cgggctttgaaccctagaccttgcatatattatgcattgtccctatcaactgag 27244667  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #23
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 688 - 744
Target Start/End: Complemental strand, 34903585 - 34903528
Alignment:
688 gtgtccgggcttcgaacc-cagatcttgtatatattatgcattgtccttatcaactga 744  Q
    ||||||||| |||||||| |||| |||| |||||||||||| |||||||| |||||||    
34903585 gtgtccggggttcgaacctcagaccttgcatatattatgcactgtccttaccaactga 34903528  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 40; Significance: 0.0000000000004; HSPs: 21)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 704 - 747
Target Start/End: Complemental strand, 18635581 - 18635538
Alignment:
704 cccagatcttgtatatattatgcattgtccttatcaactgagtt 747  Q
    |||||| |||||||||||||||||||||||||||||||||||||    
18635581 cccagaccttgtatatattatgcattgtccttatcaactgagtt 18635538  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 689 - 745
Target Start/End: Original strand, 24785456 - 24785513
Alignment:
689 tgtccgggcttcgaaccc-agatcttgtatatattatgcattgtccttatcaactgag 745  Q
    |||||||| ||||||||| ||| |||||||||||||||||||||||||| ||||||||    
24785456 tgtccggggttcgaaccccagaccttgtatatattatgcattgtccttaccaactgag 24785513  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 689 - 745
Target Start/End: Complemental strand, 24822810 - 24822753
Alignment:
689 tgtccgggcttcgaaccc-agatcttgtatatattatgcattgtccttatcaactgag 745  Q
    |||||||| ||||||||| ||| |||||||||||||||||||||||||| ||||||||    
24822810 tgtccggggttcgaaccccagaccttgtatatattatgcattgtccttaccaactgag 24822753  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 692 - 745
Target Start/End: Complemental strand, 49949397 - 49949344
Alignment:
692 ccgggcttcgaacccagatcttgtatatattatgcattgtccttatcaactgag 745  Q
    ||||| |||||||||||| |||| ||||||||||||||||||||| ||||||||    
49949397 ccgggattcgaacccagaccttgcatatattatgcattgtccttaccaactgag 49949344  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 689 - 731
Target Start/End: Complemental strand, 41346822 - 41346780
Alignment:
689 tgtccgggcttcgaacccagatcttgtatatattatgcattgt 731  Q
    |||||||| ||||||||| ||||||||||||||||||||||||    
41346822 tgtccggggttcgaaccctgatcttgtatatattatgcattgt 41346780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 706 - 747
Target Start/End: Complemental strand, 29910510 - 29910469
Alignment:
706 cagatcttgtatatattatgcattgtccttatcaactgagtt 747  Q
    ||||||||| ||||||||||||||||||||||||| ||||||    
29910510 cagatcttgcatatattatgcattgtccttatcaattgagtt 29910469  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 688 - 747
Target Start/End: Original strand, 7371541 - 7371601
Alignment:
688 gtgtccgggcttcgaacccag-atcttgtatatattatgcattgtccttatcaactgagtt 747  Q
    ||||||||| ||||||||| | | |||| |||||||||| |||||||||||||||||||||    
7371541 gtgtccggggttcgaaccccggaccttgcatatattatgtattgtccttatcaactgagtt 7371601  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 689 - 745
Target Start/End: Original strand, 7922245 - 7922301
Alignment:
689 tgtccgggcttcgaacccagatcttgtatatattatgcattgtccttatcaactgag 745  Q
    ||||| || ||||||||| ||||||| ||||||||||||||||| ||| ||||||||    
7922245 tgtccagggttcgaacccggatcttgcatatattatgcattgtctttaccaactgag 7922301  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 705 - 745
Target Start/End: Original strand, 33900735 - 33900775
Alignment:
705 ccagatcttgtatatattatgcattgtccttatcaactgag 745  Q
    |||||||||| ||||||||||||||||||||| ||||||||    
33900735 ccagatcttgcatatattatgcattgtccttaccaactgag 33900775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 716 - 747
Target Start/End: Original strand, 39842034 - 39842065
Alignment:
716 atatattatgcattgtccttatcaactgagtt 747  Q
    ||||||||||||||||||||||||||||||||    
39842034 atatattatgcattgtccttatcaactgagtt 39842065  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 716 - 747
Target Start/End: Complemental strand, 56096243 - 56096212
Alignment:
716 atatattatgcattgtccttatcaactgagtt 747  Q
    ||||||||||||||||||||||||||||||||    
56096243 atatattatgcattgtccttatcaactgagtt 56096212  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 688 - 745
Target Start/End: Original strand, 11144658 - 11144716
Alignment:
688 gtgtccgggcttcgaaccc-agatcttgtatatattatgcattgtccttatcaactgag 745  Q
    ||||||||| ||| ||||| ||| |||| ||||||||||||||||| ||||||||||||    
11144658 gtgtccggggttcaaaccccagaccttgcatatattatgcattgtctttatcaactgag 11144716  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 711 - 745
Target Start/End: Complemental strand, 12439708 - 12439674
Alignment:
711 cttgtatatattatgcattgtccttatcaactgag 745  Q
    |||| ||||||||||||||||||||||||||||||    
12439708 cttgcatatattatgcattgtccttatcaactgag 12439674  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 711 - 745
Target Start/End: Complemental strand, 36203280 - 36203246
Alignment:
711 cttgtatatattatgcattgtccttatcaactgag 745  Q
    |||| ||||||||||||||||||||||||||||||    
36203280 cttgcatatattatgcattgtccttatcaactgag 36203246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 711 - 745
Target Start/End: Original strand, 42756123 - 42756157
Alignment:
711 cttgtatatattatgcattgtccttatcaactgag 745  Q
    |||| ||||||||||||||||||||||||||||||    
42756123 cttgcatatattatgcattgtccttatcaactgag 42756157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 710 - 747
Target Start/End: Complemental strand, 20131472 - 20131435
Alignment:
710 tcttgtatatattatgcattgtccttatcaactgagtt 747  Q
    ||||||||||||||||||||||||||  ||||||||||    
20131472 tcttgtatatattatgcattgtccttgccaactgagtt 20131435  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 711 - 744
Target Start/End: Original strand, 29808285 - 29808318
Alignment:
711 cttgtatatattatgcattgtccttatcaactga 744  Q
    |||| |||||||||||||||||||||||||||||    
29808285 cttgcatatattatgcattgtccttatcaactga 29808318  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 716 - 745
Target Start/End: Original strand, 33413352 - 33413381
Alignment:
716 atatattatgcattgtccttatcaactgag 745  Q
    ||||||||||||||||||||||||||||||    
33413352 atatattatgcattgtccttatcaactgag 33413381  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 716 - 745
Target Start/End: Original strand, 46434782 - 46434811
Alignment:
716 atatattatgcattgtccttatcaactgag 745  Q
    ||||||||||||||||||||||||||||||    
46434782 atatattatgcattgtccttatcaactgag 46434811  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 704 - 745
Target Start/End: Complemental strand, 49308871 - 49308830
Alignment:
704 cccagatcttgtatatattatgcattgtccttatcaactgag 745  Q
    |||||| |||| |||||||||||||||||||| |||||||||    
49308871 cccagaccttgcatatattatgcattgtccttgtcaactgag 49308830  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 688 - 745
Target Start/End: Original strand, 50442741 - 50442798
Alignment:
688 gtgtccgggcttcgaacccagatcttgtatatattatgcattgtccttatcaactgag 745  Q
    ||||| ||| |||||||||||| |||| |||||||||||||| ||| || ||||||||    
50442741 gtgtctgggattcgaacccagaccttgcatatattatgcattatccctaccaactgag 50442798  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 39; Significance: 0.000000000002; HSPs: 10)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 688 - 745
Target Start/End: Original strand, 1244698 - 1244756
Alignment:
688 gtgtccgggcttcgaaccc-agatcttgtatatattatgcattgtccttatcaactgag 745  Q
    ||||||||| ||||||||| ||| |||||||||||||||||||||||||| ||||||||    
1244698 gtgtccggggttcgaaccccagaccttgtatatattatgcattgtccttaccaactgag 1244756  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 688 - 745
Target Start/End: Complemental strand, 19488368 - 19488310
Alignment:
688 gtgtccgggcttcgaaccc-agatcttgtatatattatgcattgtccttatcaactgag 745  Q
    ||||||||| ||||| ||| ||| |||||||||||||||||||||||||| ||||||||    
19488368 gtgtccgggattcgagccccagaccttgtatatattatgcattgtccttaccaactgag 19488310  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 711 - 745
Target Start/End: Complemental strand, 5179837 - 5179803
Alignment:
711 cttgtatatattatgcattgtccttatcaactgag 745  Q
    |||||||||||||||||||||||||| ||||||||    
5179837 cttgtatatattatgcattgtccttaccaactgag 5179803  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 701 - 747
Target Start/End: Complemental strand, 8837974 - 8837928
Alignment:
701 gaacccagatcttgtatatattatgcattgtccttatcaactgagtt 747  Q
    |||||| || ||||||||||||||||||||||| ||||||| |||||    
8837974 gaacccggaccttgtatatattatgcattgtccctatcaaccgagtt 8837928  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 712 - 742
Target Start/End: Original strand, 10256331 - 10256361
Alignment:
712 ttgtatatattatgcattgtccttatcaact 742  Q
    |||||||||||||||||||||||||||||||    
10256331 ttgtatatattatgcattgtccttatcaact 10256361  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 711 - 745
Target Start/End: Complemental strand, 14258059 - 14258025
Alignment:
711 cttgtatatattatgcattgtccttatcaactgag 745  Q
    ||||||||||||||||||||||||| |||||||||    
14258059 cttgtatatattatgcattgtccttgtcaactgag 14258025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 712 - 746
Target Start/End: Original strand, 29851651 - 29851685
Alignment:
712 ttgtatatattatgcattgtccttatcaactgagt 746  Q
    |||||||||||||||||||| ||||||||||||||    
29851651 ttgtatatattatgcattgttcttatcaactgagt 29851685  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 688 - 745
Target Start/End: Complemental strand, 30623361 - 30623303
Alignment:
688 gtgtccgggcttcgaaccc-agatcttgtatatattatgcattgtccttatcaactgag 745  Q
    |||| |||| ||||||||| ||| |||| ||||||||||||||||||||| ||||||||    
30623361 gtgttcggggttcgaaccccagaccttgcatatattatgcattgtccttaccaactgag 30623303  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 706 - 747
Target Start/End: Original strand, 8442499 - 8442540
Alignment:
706 cagatcttgtatatattatgcattgtccttatcaactgagtt 747  Q
    |||| |||| ||||||||||||||||||||| ||||||||||    
8442499 cagaccttgcatatattatgcattgtccttaccaactgagtt 8442540  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 708 - 745
Target Start/End: Original strand, 24696020 - 24696057
Alignment:
708 gatcttgtatatattatgcattgtccttatcaactgag 745  Q
    ||||||| |||||||||||||||||| |||||||||||    
24696020 gatcttgcatatattatgcattgtccatatcaactgag 24696057  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 38; Significance: 0.000000000006; HSPs: 21)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 688 - 745
Target Start/End: Original strand, 4216393 - 4216450
Alignment:
688 gtgtccgggcttcgaacccagatcttgtatatattatgcattgtccttatcaactgag 745  Q
    |||||| || ||||||||| || |||| ||||||||||||||||||||||||||||||    
4216393 gtgtccagggttcgaaccccgaccttgcatatattatgcattgtccttatcaactgag 4216450  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 688 - 747
Target Start/End: Original strand, 38573566 - 38573626
Alignment:
688 gtgtccgggcttcgaaccc-agatcttgtatatattatgcattgtccttatcaactgagtt 747  Q
    ||||||||| |||||| || ||| ||||||||||||||||||||| |||||||||||||||    
38573566 gtgtccggggttcgaatcctagaccttgtatatattatgcattgttcttatcaactgagtt 38573626  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 36; E-Value: 0.00000000009
Query Start/End: Original strand, 704 - 747
Target Start/End: Complemental strand, 17588413 - 17588370
Alignment:
704 cccagatcttgtatatattatgcattgtccttatcaactgagtt 747  Q
    ||||||||||| ||||||||||||||||||||| ||||||||||    
17588413 cccagatcttgcatatattatgcattgtccttaccaactgagtt 17588370  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 688 - 745
Target Start/End: Complemental strand, 45096094 - 45096036
Alignment:
688 gtgtccgggcttcgaacc-cagatcttgtatatattatgcattgtccttatcaactgag 745  Q
    ||||| ||| |||||||| |||| |||| ||||||||||||||||||||||||||||||    
45096094 gtgtctggggttcgaaccacagaccttgcatatattatgcattgtccttatcaactgag 45096036  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 706 - 747
Target Start/End: Complemental strand, 11574302 - 11574261
Alignment:
706 cagatcttgtatatattatgcattgtccttatcaactgagtt 747  Q
    |||| ||||||||||||||||||| |||||||||||||||||    
11574302 cagaccttgtatatattatgcattatccttatcaactgagtt 11574261  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 708 - 745
Target Start/End: Complemental strand, 13992718 - 13992681
Alignment:
708 gatcttgtatatattatgcattgtccttatcaactgag 745  Q
    ||||||||||||||||||||||||||||| ||||||||    
13992718 gatcttgtatatattatgcattgtccttaccaactgag 13992681  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 692 - 745
Target Start/End: Complemental strand, 46469340 - 46469287
Alignment:
692 ccgggcttcgaacccagatcttgtatatattatgcattgtccttatcaactgag 745  Q
    ||||| ||||||||| || |||| ||||||||||||||||||||| ||||||||    
46469340 ccgggattcgaaccccgaccttgaatatattatgcattgtccttaccaactgag 46469287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 696 - 747
Target Start/End: Original strand, 12976603 - 12976655
Alignment:
696 gcttcgaa-cccagatcttgtatatattatgcattgtccttatcaactgagtt 747  Q
    |||||||| |||||| |||| |||||||||||||||||| |||||||||||||    
12976603 gcttcgaatcccagaccttgcatatattatgcattgtccctatcaactgagtt 12976655  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 711 - 747
Target Start/End: Original strand, 39100433 - 39100469
Alignment:
711 cttgtatatattatgcattgtccttatcaactgagtt 747  Q
    ||||||||||||||||||||| |||||||||||||||    
39100433 cttgtatatattatgcattgttcttatcaactgagtt 39100469  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 711 - 747
Target Start/End: Original strand, 39869824 - 39869860
Alignment:
711 cttgtatatattatgcattgtccttatcaactgagtt 747  Q
    |||||||||||||||||||||||||| ||||||||||    
39869824 cttgtatatattatgcattgtccttaccaactgagtt 39869860  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 711 - 747
Target Start/End: Original strand, 47377366 - 47377402
Alignment:
711 cttgtatatattatgcattgtccttatcaactgagtt 747  Q
    |||||||||||||||||||||||||| ||||||||||    
47377366 cttgtatatattatgcattgtccttaccaactgagtt 47377402  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 716 - 747
Target Start/End: Complemental strand, 22462351 - 22462320
Alignment:
716 atatattatgcattgtccttatcaactgagtt 747  Q
    ||||||||||||||||||||||||||||||||    
22462351 atatattatgcattgtccttatcaactgagtt 22462320  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 711 - 746
Target Start/End: Complemental strand, 32753872 - 32753837
Alignment:
711 cttgtatatattatgcattgtccttatcaactgagt 746  Q
    ||||||||||||||||||||||| ||||||||||||    
32753872 cttgtatatattatgcattgtccctatcaactgagt 32753837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 688 - 745
Target Start/End: Original strand, 1149062 - 1149120
Alignment:
688 gtgtccgggcttcgaaccc-agatcttgtatatattatgcattgtccttatcaactgag 745  Q
    |||||| || ||||||||| ||| |||| ||||||||||||||||||||| ||||||||    
1149062 gtgtccagggttcgaaccctagaccttgcatatattatgcattgtccttaccaactgag 1149120  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 692 - 745
Target Start/End: Original strand, 8113559 - 8113613
Alignment:
692 ccgggcttcgaacc-cagatcttgtatatattatgcattgtccttatcaactgag 745  Q
    ||||| |||||||| | ||||||| ||||||||||||||||||||| ||||||||    
8113559 ccgggattcgaaccgcggatcttgcatatattatgcattgtccttaccaactgag 8113613  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 688 - 745
Target Start/End: Complemental strand, 30200894 - 30200836
Alignment:
688 gtgtccgggcttcgaacc-cagatcttgtatatattatgcattgtccttatcaactgag 745  Q
    ||||||||| |||||||| || | |||| ||||||||||||||||||||| ||||||||    
30200894 gtgtccggggttcgaacctcaaaccttgcatatattatgcattgtccttagcaactgag 30200836  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 688 - 745
Target Start/End: Original strand, 35191810 - 35191868
Alignment:
688 gtgtccgggcttcgaaccc-agatcttgtatatattatgcattgtccttatcaactgag 745  Q
    ||||| ||| ||||||||| ||| |||| ||||||||||||||||||||| ||||||||    
35191810 gtgtctggggttcgaaccccagaccttgcatatattatgcattgtccttaccaactgag 35191868  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 711 - 745
Target Start/End: Original strand, 39822189 - 39822223
Alignment:
711 cttgtatatattatgcattgtccttatcaactgag 745  Q
    |||||||||||||||||||||||||| ||||||||    
39822189 cttgtatatattatgcattgtccttaccaactgag 39822223  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 688 - 745
Target Start/End: Original strand, 54230092 - 54230150
Alignment:
688 gtgtccgggcttcgaaccc-agatcttgtatatattatgcattgtccttatcaactgag 745  Q
    ||||||||| ||||||||| | | |||| ||||||||||||||||||||| ||||||||    
54230092 gtgtccggggttcgaaccccaaaccttgcatatattatgcattgtccttaccaactgag 54230150  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 711 - 744
Target Start/End: Complemental strand, 10513673 - 10513640
Alignment:
711 cttgtatatattatgcattgtccttatcaactga 744  Q
    |||||||||||||||||||||||||| |||||||    
10513673 cttgtatatattatgcattgtccttaccaactga 10513640  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 708 - 745
Target Start/End: Original strand, 38869532 - 38869569
Alignment:
708 gatcttgtatatattatgcattgtccttatcaactgag 745  Q
    |||||||||||||||||||||||| |||| ||||||||    
38869532 gatcttgtatatattatgcattgttcttaccaactgag 38869569  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 37; Significance: 0.00000000002; HSPs: 14)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 698 - 742
Target Start/End: Original strand, 19533182 - 19533226
Alignment:
698 ttcgaacccagatcttgtatatattatgcattgtccttatcaact 742  Q
    |||||||||| |||||| |||||||||||||||||||||||||||    
19533182 ttcgaacccaaatcttgcatatattatgcattgtccttatcaact 19533226  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000009
Query Start/End: Original strand, 708 - 747
Target Start/End: Original strand, 2884462 - 2884501
Alignment:
708 gatcttgtatatattatgcattgtccttatcaactgagtt 747  Q
    |||||||||||||||||||||||||| |||||||||||||    
2884462 gatcttgtatatattatgcattgtccatatcaactgagtt 2884501  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 694 - 745
Target Start/End: Complemental strand, 15764094 - 15764042
Alignment:
694 gggcttcgaaccca-gatcttgtatatattatgcattgtccttatcaactgag 745  Q
    |||||||||||||  || |||||||||||||||||||||||||| ||||||||    
15764094 gggcttcgaacccctgaccttgtatatattatgcattgtccttaccaactgag 15764042  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 712 - 743
Target Start/End: Original strand, 5031172 - 5031203
Alignment:
712 ttgtatatattatgcattgtccttatcaactg 743  Q
    ||||||||||||||||||||||||||||||||    
5031172 ttgtatatattatgcattgtccttatcaactg 5031203  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 698 - 745
Target Start/End: Complemental strand, 9374439 - 9374392
Alignment:
698 ttcgaacccagatcttgtatatattatgcattgtccttatcaactgag 745  Q
    |||||||| |||| || ||||||||||||||||||| |||||||||||    
9374439 ttcgaaccaagattttatatatattatgcattgtccctatcaactgag 9374392  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 704 - 747
Target Start/End: Complemental strand, 39949863 - 39949820
Alignment:
704 cccagatcttgtatatattatgcattgtccttatcaactgagtt 747  Q
    |||||| ||||||||||||||||||||| |||| ||||||||||    
39949863 cccagaccttgtatatattatgcattgttcttaccaactgagtt 39949820  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 688 - 747
Target Start/End: Original strand, 49875593 - 49875652
Alignment:
688 gtgtccgggcttcgaacccagatcttgtatatattatgcattgtccttatcaactgagtt 747  Q
    ||||||||| |||||||   || |||| ||||||||||||||||||||| ||||||||||    
49875593 gtgtccggggttcgaacatggaccttgcatatattatgcattgtccttaccaactgagtt 49875652  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 704 - 746
Target Start/End: Original strand, 16033460 - 16033502
Alignment:
704 cccagatcttgtatatattatgcattgtccttatcaactgagt 746  Q
    |||||| |||| |||||||||||||||||| ||||||||||||    
16033460 cccagaccttgcatatattatgcattgtccctatcaactgagt 16033502  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 688 - 745
Target Start/End: Original strand, 38448859 - 38448917
Alignment:
688 gtgtccgggcttcgaacccag-atcttgtatatattatgcattgtccttatcaactgag 745  Q
    ||||||||| ||||||||| | | |||| ||||||||||||||||||||| ||||||||    
38448859 gtgtccgggattcgaaccccggaccttgcatatattatgcattgtccttaccaactgag 38448917  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 713 - 751
Target Start/End: Original strand, 38923029 - 38923067
Alignment:
713 tgtatatattatgcattgtccttatcaactgagttgagt 751  Q
    ||||||| ||||||||||||||||||||||||| |||||    
38923029 tgtatattttatgcattgtccttatcaactgagatgagt 38923067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 704 - 745
Target Start/End: Original strand, 24236628 - 24236669
Alignment:
704 cccagatcttgtatatattatgcattgtccttatcaactgag 745  Q
    |||||| |||||| ||||||||||||||||||| ||||||||    
24236628 cccagaccttgtaaatattatgcattgtccttaccaactgag 24236669  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 706 - 747
Target Start/End: Original strand, 28039872 - 28039913
Alignment:
706 cagatcttgtatatattatgcattgtccttatcaactgagtt 747  Q
    |||| |||| ||||||||||||||||||||| ||||||||||    
28039872 cagaccttgcatatattatgcattgtccttaccaactgagtt 28039913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 706 - 747
Target Start/End: Original strand, 45773554 - 45773595
Alignment:
706 cagatcttgtatatattatgcattgtccttatcaactgagtt 747  Q
    |||||||||||||| ||||||||||||| || ||||||||||    
45773554 cagatcttgtatattttatgcattgtccgtaccaactgagtt 45773595  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 706 - 747
Target Start/End: Complemental strand, 46334824 - 46334783
Alignment:
706 cagatcttgtatatattatgcattgtccttatcaactgagtt 747  Q
    |||| ||||||||| ||||||||||| |||||||||||||||    
46334824 cagaccttgtatattttatgcattgttcttatcaactgagtt 46334783  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 35; Significance: 0.0000000004; HSPs: 16)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 698 - 747
Target Start/End: Complemental strand, 6610135 - 6610085
Alignment:
698 ttcgaaccc-agatcttgtatatattatgcattgtccttatcaactgagtt 747  Q
    ||||||||| |||||||| ||||||||||||||| ||||||||||||||||    
6610135 ttcgaaccctagatcttgcatatattatgcattgcccttatcaactgagtt 6610085  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 701 - 745
Target Start/End: Complemental strand, 18256937 - 18256893
Alignment:
701 gaacccagatcttgtatatattatgcattgtccttatcaactgag 745  Q
    |||||| || |||| ||||||||||||||||||||||||||||||    
18256937 gaacccggaccttgcatatattatgcattgtccttatcaactgag 18256893  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 709 - 745
Target Start/End: Complemental strand, 26522518 - 26522482
Alignment:
709 atcttgtatatattatgcattgtccttatcaactgag 745  Q
    |||||||||||||||||||||||||||| ||||||||    
26522518 atcttgtatatattatgcattgtccttaccaactgag 26522482  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 693 - 747
Target Start/End: Complemental strand, 2445362 - 2445307
Alignment:
693 cgggcttcgaacccaga-tcttgtatatattatgcattgtccttatcaactgagtt 747  Q
    |||| ||||||||| || |||||||||||||||||||||| | |||||||||||||    
2445362 cggggttcgaaccccgaatcttgtatatattatgcattgttcatatcaactgagtt 2445307  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 704 - 747
Target Start/End: Original strand, 3373391 - 3373434
Alignment:
704 cccagatcttgtatatattatgcattgtccttatcaactgagtt 747  Q
    |||| |||||| |||||||||||||||||| |||||||||||||    
3373391 cccaaatcttgcatatattatgcattgtccatatcaactgagtt 3373434  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 708 - 747
Target Start/End: Original strand, 6864147 - 6864186
Alignment:
708 gatcttgtatatattatgcattgtccttatcaactgagtt 747  Q
    ||||||| |||||||||||||||||||| |||||||||||    
6864147 gatcttgcatatattatgcattgtccttttcaactgagtt 6864186  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 704 - 747
Target Start/End: Original strand, 14169555 - 14169598
Alignment:
704 cccagatcttgtatatattatgcattgtccttatcaactgagtt 747  Q
    |||| |||||| ||||||| ||||||||||||||||||||||||    
14169555 cccaaatcttgcatatattctgcattgtccttatcaactgagtt 14169598  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 701 - 747
Target Start/End: Complemental strand, 1769822 - 1769776
Alignment:
701 gaacccagatcttgtatatattatgcattgtccttatcaactgagtt 747  Q
    ||||||||| |||| |||| ||||||||||||||| |||||||||||    
1769822 gaacccagaccttgcatattttatgcattgtccttgtcaactgagtt 1769776  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 711 - 745
Target Start/End: Complemental strand, 9923284 - 9923250
Alignment:
711 cttgtatatattatgcattgtccttatcaactgag 745  Q
    |||||||||||||||||||||||||||||| ||||    
9923284 cttgtatatattatgcattgtccttatcaattgag 9923250  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 711 - 745
Target Start/End: Complemental strand, 33824925 - 33824891
Alignment:
711 cttgtatatattatgcattgtccttatcaactgag 745  Q
    |||| ||||||||||||||||||||||||||||||    
33824925 cttgcatatattatgcattgtccttatcaactgag 33824891  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 704 - 745
Target Start/End: Complemental strand, 334191 - 334150
Alignment:
704 cccagatcttgtatatattatgcattgtccttatcaactgag 745  Q
    |||||| |||| ||||||||||||||||| ||||||||||||    
334191 cccagaccttgcatatattatgcattgtctttatcaactgag 334150  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 708 - 745
Target Start/End: Complemental strand, 2692262 - 2692225
Alignment:
708 gatcttgtatatattatgcattgtccttatcaactgag 745  Q
    ||||||| |||||||||||||||||| |||||||||||    
2692262 gatcttgcatatattatgcattgtccatatcaactgag 2692225  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 706 - 747
Target Start/End: Complemental strand, 10278502 - 10278461
Alignment:
706 cagatcttgtatatattatgcattgtccttatcaactgagtt 747  Q
    ||||||||| |||||||||||||||||| |||||| ||||||    
10278502 cagatcttgcatatattatgcattgtccatatcaattgagtt 10278461  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 704 - 745
Target Start/End: Original strand, 14918310 - 14918351
Alignment:
704 cccagatcttgtatatattatgcattgtccttatcaactgag 745  Q
    |||||| ||||||||||||||||||||||| || ||||||||    
14918310 cccagaccttgtatatattatgcattgtccctaccaactgag 14918351  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 708 - 741
Target Start/End: Original strand, 26303824 - 26303857
Alignment:
708 gatcttgtatatattatgcattgtccttatcaac 741  Q
    |||||||||||||||||| |||||||||||||||    
26303824 gatcttgtatatattatgtattgtccttatcaac 26303857  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #16
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 712 - 745
Target Start/End: Original strand, 26521133 - 26521166
Alignment:
712 ttgtatatattatgcattgtccttatcaactgag 745  Q
    ||||||||||||||||||||||||| ||||||||    
26521133 ttgtatatattatgcattgtccttaccaactgag 26521166  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0045 (Bit Score: 31; Significance: 0.00000009; HSPs: 1)
Name: scaffold0045
Description:

Target: scaffold0045; HSP #1
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 717 - 751
Target Start/End: Complemental strand, 32821 - 32787
Alignment:
717 tatattatgcattgtccttatcaactgagttgagt 751  Q
    |||||||||||||||||||||||| ||||||||||    
32821 tatattatgcattgtccttatcaattgagttgagt 32787  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0016 (Bit Score: 31; Significance: 0.00000009; HSPs: 1)
Name: scaffold0016
Description:

Target: scaffold0016; HSP #1
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 704 - 746
Target Start/End: Complemental strand, 99088 - 99046
Alignment:
704 cccagatcttgtatatattatgcattgtccttatcaactgagt 746  Q
    |||||| |||| |||||||||||||||||| ||||||||||||    
99088 cccagaccttgcatatattatgcattgtccctatcaactgagt 99046  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 106060 times since January 2019
Visitors: 1319