View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5_2_94 (Length: 187)

Name: J5_2_94
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5_2_94
J5_2_94
[»] chr2 (3 HSPs)
chr2 (1-187)||(43418139-43418325)
chr2 (74-168)||(43406330-43406424)
chr2 (1-59)||(43403531-43403590)


Alignment Details
Target: chr2 (Bit Score: 187; Significance: 1e-101; HSPs: 3)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 187
Target Start/End: Original strand, 43418139 - 43418325
Alignment:
1 cttttcctttcctcatcaagtaatatgctctgacacgaagcctgtgggaattgatgcattcatgcatggaggagttagttgaggctgctttctcactaac 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43418139 cttttcctttcctcatcaagtaatatgctctgacacgaagcctgtgggaattgatgcattcatgcatggaggagttagttgaggctgctttctcactaac 43418238  T
101 aagtgacatttatgtgttattcttcttttctggcactggcagcatcaattcttctactcataatcatcatcttcagaaagtatccac 187  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43418239 aagtgacatttatgtgttattcttcttttctggcactggcagcatcaattcttctactcataatcatcatcttcagaaagtatccac 43418325  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 63; E-Value: 1e-27
Query Start/End: Original strand, 74 - 168
Target Start/End: Original strand, 43406330 - 43406424
Alignment:
74 gttagttgaggctgctttctcactaacaagtgacatttatgtgttattcttcttttctggcactggcagcatcaattcttctactcataatcatc 168  Q
    |||||| |||| || ||||||| | |||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||| ||||||    
43406330 gttagtcgaggttgttttctcattcacaagtgacatttatgtgttattcttcttttcgggcattggcagcatcaattcttctactcatcatcatc 43406424  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 43403531 - 43403590
Alignment:
1 cttttcctttcctcatcaagtaatatgctctgacacgaag-cctgtgggaattgatgcat 59  Q
    |||||||||||||||||||||||||||||| ||||||||| ||||| |||||||||||||    
43403531 cttttcctttcctcatcaagtaatatgctccgacacgaagccctgtaggaattgatgcat 43403590  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 204581 times since January 2019
Visitors: 1518