View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5_3_2 (Length: 561)

Name: J5_3_2
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5_3_2
J5_3_2
[»] chr8 (1 HSPs)
chr8 (18-499)||(1970380-1970857)


Alignment Details
Target: chr8 (Bit Score: 420; Significance: 0; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 420; E-Value: 0
Query Start/End: Original strand, 18 - 499
Target Start/End: Original strand, 1970380 - 1970857
Alignment:
18 catttcctcagcttcatcataggtaatccatcctcccattctagttctcttcatcaaggaaacctagttgctccattctctgttataatgtcaccattat 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1970380 catttcctcagcttcatcataggtaatccatcctcccattctagttctcttcatcaaggaaacctagttgctccattctctgttataatgtcaccattat 1970479  T
118 catctggaacaccatcaaatatgcttaaaaaattattaggtgcatgtaacccagggtaattctgataacaatcatgattctcctccataagataatttgt 217  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1970480 catctggaacaccatcaaatatgcttaaaaaattattaggtgcatgtaacccagggtaattctgataacaatcatgattctcctccataagataatttgt 1970579  T
218 cacnnnnnnncctttattattattatacgcatcatatttgatgtggcgatgcattcgagcaatttgcatgtgccaagcagtccagtcagggcgactccaa 317  Q
    |||       ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1970580 cactttttttcctttattattattatacgcatcatatttgatgtggcgatgcattcgagcaatttgcatgtgccaagcagtccagtcagggcgactccaa 1970679  T
318 aggtaaagaggcggcggcttcaggttccagtcttccaattgcttatctcgagtatcgacagaaccaggcagataaaacgactggaggaataaacaaaacg 417  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1970680 aggtaaagaggcggcggcttcaggttccagtcttccaattgcttatctcgagtatcgacagaaccaggcagataaaacgactggaggaataaacaaaacg 1970779  T
418 aaagacatatatnagcccttgggttnagtcacacaatccttgggattaaaatcaccgaaattttaaacaaactcacctttcc 499  Q
    |||||||||||| ||||||| |||| ||||||||||||  | |||||||||||| ||||||||| |||||||||||||||||    
1970780 aaagacatatataagccctt-ggtttagtcacacaatc--ttggattaaaatcatcgaaatttt-aacaaactcacctttcc 1970857  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 201318 times since January 2019
Visitors: 1513