View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5_3_26 (Length: 162)

Name: J5_3_26
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5_3_26
J5_3_26
[»] chr3 (1 HSPs)
chr3 (1-162)||(55180304-55180465)


Alignment Details
Target: chr3 (Bit Score: 158; Significance: 2e-84; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 158; E-Value: 2e-84
Query Start/End: Original strand, 1 - 162
Target Start/End: Original strand, 55180304 - 55180465
Alignment:
1 gattgaagtaagacaatgtgtttccgttatatcttgacagccacacatacaagacatcaagatcaaactcatgtccaaaaaactatcaatataatgtctc 100  Q
    |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
55180304 gattgaagtaagacaatgtgtttccgttatatcttgacagtcacacatacaagacatcaagatcaaactcatgtccaaaaaactatcaatataatgtctc 55180403  T
101 gaatgcgtcaatgtgtgaccaaatgtcaataaatgaaattttttcaaatcttcaaaatttcg 162  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
55180404 gaatgcgtcaatgtgtgaccaaatgtcaataaatgaaattttttcaaatcttcaaaatttcg 55180465  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 309601 times since January 2019
Visitors: 444