View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: J5_3_35 (Length: 144)
Name: J5_3_35
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] J5_3_35 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 55; Significance: 6e-23; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 55; E-Value: 6e-23
Query Start/End: Original strand, 1 - 55
Target Start/End: Original strand, 52629991 - 52630045
Alignment:
Q |
1 |
ctgatcttaagcacatttttaaggttgtcatatttttagctgcttagaccttagt |
55 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
52629991 |
ctgatcttaagcacatttttaaggttgtcatatttttagctgcttagaccttagt |
52630045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 46; E-Value: 1e-17
Query Start/End: Original strand, 99 - 144
Target Start/End: Original strand, 52630089 - 52630134
Alignment:
Q |
99 |
gcgctgctgttgtgagtgagtgtactgtaagtgttttatctattaa |
144 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
52630089 |
gcgctgctgttgtgagtgagtgtactgtaagtgttttatctattaa |
52630134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Noble Research Institute, LLC
This website was viewed 175862 times since January 2019
Visitors: 1577