View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5_3_35 (Length: 144)

Name: J5_3_35
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5_3_35
J5_3_35
[»] chr4 (2 HSPs)
chr4 (1-55)||(52629991-52630045)
chr4 (99-144)||(52630089-52630134)


Alignment Details
Target: chr4 (Bit Score: 55; Significance: 6e-23; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 55; E-Value: 6e-23
Query Start/End: Original strand, 1 - 55
Target Start/End: Original strand, 52629991 - 52630045
Alignment:
1 ctgatcttaagcacatttttaaggttgtcatatttttagctgcttagaccttagt 55  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52629991 ctgatcttaagcacatttttaaggttgtcatatttttagctgcttagaccttagt 52630045  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 46; E-Value: 1e-17
Query Start/End: Original strand, 99 - 144
Target Start/End: Original strand, 52630089 - 52630134
Alignment:
99 gcgctgctgttgtgagtgagtgtactgtaagtgttttatctattaa 144  Q
    ||||||||||||||||||||||||||||||||||||||||||||||    
52630089 gcgctgctgttgtgagtgagtgtactgtaagtgttttatctattaa 52630134  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 175862 times since January 2019
Visitors: 1577