View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5_3_39 (Length: 347)

Name: J5_3_39
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5_3_39
J5_3_39
[»] chr4 (1 HSPs)
chr4 (1-347)||(50950945-50951291)


Alignment Details
Target: chr4 (Bit Score: 343; Significance: 0; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 343; E-Value: 0
Query Start/End: Original strand, 1 - 347
Target Start/End: Original strand, 50950945 - 50951291
Alignment:
1 ggagtcaggtttaagtcactatatgcatctgtgcttgtattcgtttgtcttttataggactggtctagatggtatgttggatgcgtcgttggtatgttgg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
50950945 ggagtcaggtttaagtcactatatgcatctgtgcttgtattcgtttgtcttttataggactggtctagatggtatgttggatgtgtcgttggtatgttgg 50951044  T
101 tagtttgcagcagaatttggaggtggtgcctagttgcttttattgtattggtattggtatgttctgctttagagattgctgactataggcggatatagag 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
50951045 tagtttgcagcagaatttggaggtggtgcctagttgcttttattgtattggtattggtatgttctgctttagagattgctgactataggcggatatagag 50951144  T
201 attgctgacatttttacctaggcattaagaatcgacccattcaaagagaatgatgctaagcattatacacttatatacattggattgaaggagagtgttg 300  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
50951145 attgctgacatttttacctaggcattaagaatcgacccattcaaagagaatgatgctaagcattatacacttatatacattggattgaaggagagtgttg 50951244  T
301 tgaatacaattcaatgtattgggttaaacacttgagctttgtatcaa 347  Q
    |||||||||||||||||||||||||||||||||||||||||||||||    
50951245 tgaatacaattcaatgtattgggttaaacacttgagctttgtatcaa 50951291  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 315748 times since January 2019
Visitors: 447