View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5_3_53 (Length: 236)

Name: J5_3_53
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5_3_53
J5_3_53
[»] chr6 (2 HSPs)
chr6 (12-181)||(33815235-33815404)
chr6 (178-236)||(33815411-33815469)
[»] chr2 (3 HSPs)
chr2 (119-165)||(43966929-43966974)
chr2 (119-161)||(40987515-40987557)
chr2 (121-160)||(27935232-27935271)
[»] chr5 (1 HSPs)
chr5 (119-161)||(3236179-3236221)
[»] chr4 (1 HSPs)
chr4 (119-153)||(1518421-1518455)
[»] chr1 (1 HSPs)
chr1 (119-167)||(28298685-28298733)


Alignment Details
Target: chr6 (Bit Score: 170; Significance: 2e-91; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 12 - 181
Target Start/End: Complemental strand, 33815404 - 33815235
Alignment:
12 atttgaaaagtgatagtaacattcactctatcattgtctattgaacacattttctcttatgagatcaaatttacatagatcacaccattttgaaaataat 111  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33815404 atttgaaaagtgatagtaacattcactctatcattgtctattgaacacattttctcttatgagatcaaatttacatagatcacaccattttgaaaataat 33815305  T
112 tctacacacaatactaccaaacaaactaatataatatgcttaaaagatccccttttggaaagcaccaatt 181  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33815304 tctacacacaatactaccaaacaaactaatataatatgcttaaaagatccccttttggaaagcaccaatt 33815235  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 178 - 236
Target Start/End: Complemental strand, 33815469 - 33815411
Alignment:
178 aattctacaagtattttgtgttggtgtaatttgaaatctcagggagcaatgcttgaatt 236  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33815469 aattctacaagtattttgtgttggtgtaatttgaaatctcagggagcaatgcttgaatt 33815411  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 3)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 119 - 165
Target Start/End: Complemental strand, 43966974 - 43966929
Alignment:
119 acaatactaccaaacaaactaatataatatgcttaaaagatcccctt 165  Q
    |||||||||| ||||||||||||||||||||||||||||||||||||    
43966974 acaatactac-aaacaaactaatataatatgcttaaaagatcccctt 43966929  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 119 - 161
Target Start/End: Complemental strand, 40987557 - 40987515
Alignment:
119 acaatactaccaaacaaactaatataatatgcttaaaagatcc 161  Q
    ||||||||| |||||||||||||| ||||||||||||||||||    
40987557 acaatactatcaaacaaactaatagaatatgcttaaaagatcc 40987515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 121 - 160
Target Start/End: Complemental strand, 27935271 - 27935232
Alignment:
121 aatactaccaaacaaactaatataatatgcttaaaagatc 160  Q
    |||||||||||||||| |||||||||||| ||||||||||    
27935271 aatactaccaaacaaattaatataatatgtttaaaagatc 27935232  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 119 - 161
Target Start/End: Complemental strand, 3236221 - 3236179
Alignment:
119 acaatactaccaaacaaactaatataatatgcttaaaagatcc 161  Q
    ||||||||| |||||||| ||||| ||||||||||||||||||    
3236221 acaatactatcaaacaaattaatagaatatgcttaaaagatcc 3236179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 119 - 153
Target Start/End: Original strand, 1518421 - 1518455
Alignment:
119 acaatactaccaaacaaactaatataatatgctta 153  Q
    |||||||||||||||||||||||| ||||||||||    
1518421 acaatactaccaaacaaactaatagaatatgctta 1518455  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 119 - 167
Target Start/End: Original strand, 28298685 - 28298733
Alignment:
119 acaatactaccaaacaaactaatataatatgcttaaaagatcccctttt 167  Q
    ||||| |||||||||||||||||| ||||||| ||||| |||| |||||    
28298685 acaatgctaccaaacaaactaatagaatatgcctaaaaaatccactttt 28298733  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 310122 times since January 2019
Visitors: 444