View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5_3_59 (Length: 411)

Name: J5_3_59
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5_3_59
J5_3_59
[»] chr8 (4 HSPs)
chr8 (157-411)||(8333714-8333968)
chr8 (1-162)||(8333964-8334125)
chr8 (157-347)||(15580628-15580819)
chr8 (305-353)||(12049457-12049505)
[»] chr5 (1 HSPs)
chr5 (1-148)||(11909398-11909546)
[»] scaffold0003 (1 HSPs)
scaffold0003 (279-340)||(41538-41598)
[»] chr6 (1 HSPs)
chr6 (279-340)||(27445760-27445820)


Alignment Details
Target: chr8 (Bit Score: 255; Significance: 1e-142; HSPs: 4)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 157 - 411
Target Start/End: Original strand, 8333714 - 8333968
Alignment:
157 caattgatatttcggagattttaaatggtatccatccaagcttgaacgactcatcaaatggtgcacaacaatccattagtgatgaaactcttgctagact 256  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8333714 caattgatatttcggagattttaaatggtatccatccaagcttgaacgactcatcaaatggtgcacaacaatccattagtgatgaaactcttgctagact 8333813  T
257 aaatgaatctgttcttttattaaagcaggaaaagcaacaaagtctacaaaaggtgacattttctgatctagatgaaatactgcaaatgaatttatacccg 356  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8333814 aaatgaatctgttcttttattaaagcaggaaaagcaacaaagtctacaaaaggtgacattttctgatctagatgaaatactgcaaatgaatttatacccg 8333913  T
357 tggttgctgtacgtgtctcactgttgctattgcaagtaatacggctggatcatct 411  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8333914 tggttgctgtacgtgtctcactgttgctattgcaagtaatacggctggatcatct 8333968  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 1 - 162
Target Start/End: Original strand, 8333964 - 8334125
Alignment:
1 catctcattcgatacatcaaatgatcaccgttaaagctgtaccaacagttatagtttagtgttaaatggttattggtatcctaatcaatttactcatttc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8333964 catctcattcgatacatcaaatgatcaccgttaaagctgtaccaacagttatagtttagtgttaaatggttattggtatcctaatcaatttactcatttc 8334063  T
101 ttgcatcgaattgcagtagcttttgctacctgtctcttaatttcttgctgatatcacaattg 162  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8334064 ttgcatcgaattgcagtagcttttgctacctgtctcttaatttcttgctgatatcacaattg 8334125  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 157 - 347
Target Start/End: Complemental strand, 15580819 - 15580628
Alignment:
157 caattgatatttcggagattttaaatggtatccatccaagcttgaacgactcatcaaatggtgcacaacaatccattagtgatgaaactcttgctagact 256  Q
    |||||||||||| | ||| |||||| |  ||||| |||||| ||| ||  |||||||||||||||| ||||| ||||||| |||| |||||||||||| |    
15580819 caattgatatttggaagactttaaacgacatccacccaagcctgagcggttcatcaaatggtgcaccacaatgcattagtaatgacactcttgctagatt 15580720  T
257 aaatgaatctgttcttttattaaagcaggaaaagcaacaaagtctacaaaaggtgacattttctgatctaga-tgaaatactgcaaatgaat 347  Q
    || ||    |||||||| |||||||||||||||||||||||| |||||||||||||| ||||||||||| || |||| ||||||||||||||    
15580719 aactggggttgttctttcattaaagcaggaaaagcaacaaaggctacaaaaggtgactttttctgatctggattgaactactgcaaatgaat 15580628  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 305 - 353
Target Start/End: Original strand, 12049457 - 12049505
Alignment:
305 aaaggtgacattttctgatctagat-gaaatactgcaaatgaatttatac 353  Q
    ||||||||| |||||||||| |||| ||||||||||||||||||||||||    
12049457 aaaggtgac-ttttctgatcaagattgaaatactgcaaatgaatttatac 12049505  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 89; Significance: 9e-43; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 89; E-Value: 9e-43
Query Start/End: Original strand, 1 - 148
Target Start/End: Complemental strand, 11909546 - 11909398
Alignment:
1 catctcattcgatacatcaaatgatcaccgttaaagctgtaccaacagttatagtttagtgttaaatggttattggtatcctaatcaatttactcatttc 100  Q
    |||||||||||||||||||||||||||| || |||| |||||||| ||||||||||||||||| ||||| |||| |||||||| |||||||||||||| |    
11909546 catctcattcgatacatcaaatgatcactgtaaaagatgtaccaatagttatagtttagtgttgaatggatattagtatcctagtcaatttactcattac 11909447  T
101 ttgcatcgaattgcagtagcttttgcta-cctgtctcttaatttcttgc 148  Q
    |||||| |||||||| ||||||||| || ||||||||||||||| ||||    
11909446 ttgcattgaattgcactagcttttgataccctgtctcttaatttgttgc 11909398  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0003 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0003
Description:

Target: scaffold0003; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 279 - 340
Target Start/End: Complemental strand, 41598 - 41538
Alignment:
279 aagcaggaaaagcaacaaagtctacaaaaggtgacattttctgatctagatgaaatactgca 340  Q
    ||||||||||| |||||||| |||  ||||||||| |||| ||||||| |||||||||||||    
41598 aagcaggaaaa-caacaaaggctatgaaaggtgactttttatgatctatatgaaatactgca 41538  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 279 - 340
Target Start/End: Original strand, 27445760 - 27445820
Alignment:
279 aagcaggaaaagcaacaaagtctacaaaaggtgacattttctgatctagatgaaatactgca 340  Q
    ||||||||||| |||||||| |||  ||||||||| |||| ||||||| |||||||||||||    
27445760 aagcaggaaaa-caacaaaggctatgaaaggtgactttttatgatctatatgaaatactgca 27445820  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 106163 times since January 2019
Visitors: 1319