View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5_3_60 (Length: 238)

Name: J5_3_60
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5_3_60
J5_3_60
[»] chr6 (2 HSPs)
chr6 (1-130)||(4591888-4592017)
chr6 (127-238)||(4591781-4591892)


Alignment Details
Target: chr6 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 1 - 130
Target Start/End: Original strand, 4591888 - 4592017
Alignment:
1 atctctgcaaagtatttctgcctacaagatttgataggattctacatatgatttttattttgttttgaaaaaatggatcggatccttcacatgaacatga 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4591888 atctctgcaaagtatttctgcctacaagatttgataggattctacatatgatttttattttgttttgaaaaaatggatcggatccttcacatgaacatga 4591987  T
101 taatgaaattcaagataccgtgaaagaatt 130  Q
    ||||||||||||||||||||||||||||||    
4591988 taatgaaattcaagataccgtgaaagaatt 4592017  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 127 - 238
Target Start/End: Original strand, 4591781 - 4591892
Alignment:
127 aattgtttaggttacttcctcaaatatctcaaaatataataaacatggggtgatctgataagattcaacgcgtaaaaaagctttacaccgtcagttttca 226  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4591781 aattgtttaggttacttcctcaaatatctcaaaatataataaacatggggtgatctgataagattcaacgcgtaaaaaagctttacaccgtcagttttca 4591880  T
227 gcaattaatctc 238  Q
    ||||||||||||    
4591881 gcaattaatctc 4591892  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 110993 times since January 2019
Visitors: 1335