View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5_3_62 (Length: 286)

Name: J5_3_62
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5_3_62
J5_3_62
[»] chr8 (9 HSPs)
chr8 (92-284)||(38865318-38865510)
chr8 (1-97)||(38865771-38865867)
chr8 (96-277)||(38841273-38841451)
chr8 (96-277)||(38861891-38862068)
chr8 (92-202)||(38827484-38827591)
chr8 (96-202)||(38847066-38847169)
chr8 (92-175)||(38850576-38850659)
chr8 (96-177)||(38859008-38859089)
chr8 (3-68)||(38862383-38862444)


Alignment Details
Target: chr8 (Bit Score: 187; Significance: 1e-101; HSPs: 9)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 92 - 284
Target Start/End: Original strand, 38865318 - 38865510
Alignment:
92 caattgggtcttgaaagagtaaccttcttgtgtgagattccacaagaagctcatggacgagttgtgaagtaaaggaagtagaagcagcatacattgtttt 191  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38865318 caattgggtcttgaaagagtaaccttcttgtgtgagattccacaagaagctcatggacgagttgtgaagtaaaggaagtagaagcagcatacattgtttt 38865417  T
192 ttgttggggaactagttgatagttatttaattagagattgagttgttggtatgttatcttagatgaggattatatatagggaagttntnctcg 284  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||    
38865418 ttgttggggaactagttgatagttatttaattagagattgagttgttggtatgttatcttagatgaggattatatatagggaagttatactcg 38865510  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 1 - 97
Target Start/End: Original strand, 38865771 - 38865867
Alignment:
1 tcttcatgcaagtggttatatcgcaatatatatgttttgtttaagaagacgtggttcctaattaaagcgggcgggataatgtaaatgacaacaattg 97  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38865771 tcttcatgcaagtggttatatcgcaatatatatgttttgtttaagaagacgtggttcctaattaaagcgggcgggataatgtaaatgacaacaattg 38865867  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 77; E-Value: 9e-36
Query Start/End: Original strand, 96 - 277
Target Start/End: Original strand, 38841273 - 38841451
Alignment:
96 tgggtcttgaaagagtaaccttcttgtgtgagattccacaagaagctcatggacgagttgtgaagtaaaggaagtagaagcagcatacattgttttttgt 195  Q
    ||||| ||||| ||||||||||||| |||||||||||||||||||||||| ||  | ||||| |||||||||| ||||   |||||||| |||||||| |    
38841273 tgggttttgaatgagtaaccttcttatgtgagattccacaagaagctcattgaatatttgtgtagtaaaggaaataga---agcataca-tgttttttct 38841368  T
196 tggggaactagttgat-agttatttaattagagattgagttgttggtatgttatcttagatgaggattatatatagggaagtt 277  Q
    || |||| || ||||| ||||| || ||||||| ||||||||||  ||||||||||||| |||||||||||||||||||||||    
38841369 tgaggaagtaattgatgagttagtttattagagcttgagttgtttttatgttatcttagttgaggattatatatagggaagtt 38841451  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 96 - 277
Target Start/End: Original strand, 38861891 - 38862068
Alignment:
96 tgggtcttgaaagagtaaccttcttgtgtgagattccacaagaagctcatggacgagttgtgaagtaaaggaagtagaagcagcatacattgttttttgt 195  Q
    ||||| ||||| ||||||||||||||||||||||||||||||||| |||||||  ||| |||||||||||||||||||   |||||||||||||||||||    
38861891 tgggttttgaatgagtaaccttcttgtgtgagattccacaagaagttcatggagaagtggtgaagtaaaggaagtaga---agcatacattgttttttgt 38861987  T
196 tggggaactagttgatagttatttaattagagattgagttgttggtatgt--tatcttagatgaggattatatatagggaagtt 277  Q
    ||||||| |  ||   ||||| |||||||||| |||||||| || |||||  |||||||| | |||  ||||||||||||||||    
38861988 tggggaatt--ttatgagttagttaattagagcttgagttgctgttatgttgtatcttag-ttaggggtatatatagggaagtt 38862068  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 92 - 202
Target Start/End: Original strand, 38827484 - 38827591
Alignment:
92 caattgggtcttgaaagagtaaccttcttgtgtgagattccacaagaagctcatggacgagttgtgaagtaaaggaagtagaagcagcatacattgtttt 191  Q
    ||||||| | ||| |||||||||||||||||||| ||||| |||||||||||||||| ||||||||||||||| ||||||||   |||||||||||||||    
38827484 caattggattttggaagagtaaccttcttgtgtgtgattctacaagaagctcatggaggagttgtgaagtaaaagaagtaga---agcatacattgtttt 38827580  T
192 ttgttggggaa 202  Q
     ||||||||||    
38827581 ctgttggggaa 38827591  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 96 - 202
Target Start/End: Original strand, 38847066 - 38847169
Alignment:
96 tgggtcttgaaagagtaaccttcttgtgtgagattccacaagaagctcatggacgagttgtgaagtaaaggaagtagaagcagcatacattgttttttgt 195  Q
    ||||| ||| |||||||||||||||||||| ||||| |||||||||||||||| ||||||||||||||| ||||||||   ||||||||||||||| |||    
38847066 tgggttttggaagagtaaccttcttgtgtgtgattctacaagaagctcatggaggagttgtgaagtaaaagaagtaga---agcatacattgttttctgt 38847162  T
196 tggggaa 202  Q
    |||||||    
38847163 tggggaa 38847169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 92 - 175
Target Start/End: Complemental strand, 38850659 - 38850576
Alignment:
92 caattgggtcttgaaagagtaaccttcttgtgtgagattccacaagaagctcatggacgagttgtgaagtaaaggaagtagaag 175  Q
    ||||||| | ||| |||||||||||||||||||| ||||| |||||||||||||||| |||||||||||| |||||||||||||    
38850659 caattggattttggaagagtaaccttcttgtgtgtgattctacaagaagctcatggaggagttgtgaagttaaggaagtagaag 38850576  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 96 - 177
Target Start/End: Original strand, 38859008 - 38859089
Alignment:
96 tgggtcttgaaagagtaaccttcttgtgtgagattccacaagaagctcatggacgagttgtgaagtaaaggaagtagaagca 177  Q
    ||||| ||||| ||||||||||||||||||||||||||||||||||||||| |  ||| |||||||||| ||||||||||||    
38859008 tgggttttgaatgagtaaccttcttgtgtgagattccacaagaagctcatgtagaagtggtgaagtaaaagaagtagaagca 38859089  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 3 - 68
Target Start/End: Original strand, 38862383 - 38862444
Alignment:
3 ttcatgcaagtggttatatcgcaatatatatgttttgtttaagaagacgtggttcctaattaaagc 68  Q
    |||||||||||||||| |||| ||||||| ||    |||||||||| ||||| |||||||||||||    
38862383 ttcatgcaagtggttagatcgtaatatatttg----gtttaagaagtcgtggctcctaattaaagc 38862444  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 306987 times since January 2019
Visitors: 441