View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5_3_63 (Length: 149)

Name: J5_3_63
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5_3_63
J5_3_63
[»] chr6 (1 HSPs)
chr6 (1-149)||(3254515-3254663)


Alignment Details
Target: chr6 (Bit Score: 149; Significance: 5e-79; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 149; E-Value: 5e-79
Query Start/End: Original strand, 1 - 149
Target Start/End: Original strand, 3254515 - 3254663
Alignment:
1 gaatcacataaaaatctgaaagaactaacaataacagaaggaacaaggcaactcaaaatggatgcttatggaaaatatcaaaacctcaagaaaaaacatc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3254515 gaatcacataaaaatctgaaagaactaacaataacagaaggaacaaggcaactcaaaatggatgcttatggaaaatatcaaaacctcaagaaaaaacatc 3254614  T
101 ttcaccatgaagtttattaaataatatcttgcctacacagaatcaaaac 149  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||    
3254615 ttcaccatgaagtttattaaataatatcttgcctacacagaatcaaaac 3254663  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 202445 times since January 2019
Visitors: 1515