View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5_3_76 (Length: 552)

Name: J5_3_76
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5_3_76
J5_3_76
[»] chr8 (10 HSPs)
chr8 (1-458)||(38865318-38865775)
chr8 (213-454)||(38841273-38841505)
chr8 (273-454)||(38861891-38862068)
chr8 (453-527)||(38865794-38865867)
chr8 (348-458)||(38827484-38827591)
chr8 (348-454)||(38847066-38847169)
chr8 (378-458)||(38850579-38850659)
chr8 (373-454)||(38859008-38859089)
chr8 (203-256)||(38850413-38850465)
chr8 (14-63)||(38862323-38862372)


Alignment Details
Target: chr8 (Bit Score: 450; Significance: 0; HSPs: 10)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 450; E-Value: 0
Query Start/End: Original strand, 1 - 458
Target Start/End: Complemental strand, 38865775 - 38865318
Alignment:
1 gaagattgtacttaaacaaatatttcatatggcaaaaagtattatttacggatccaattatattctaataagatttatctagctaggtgagtgggcggcc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38865775 gaagattgtacttaaacaaatatttcatatggcaaaaagtattatttacggatccaattatattctaataagatttatctagctaggtgagtgggcggcc 38865676  T
101 ataatatatttatatacacataaaggaattatgcatcaagacgagagctaaacttgtagtgcattcacatagtaactgatttaatttaaagtacctaggc 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38865675 ataatatatttatatacacataaaggaattatgcatcaagacgagagctaaacttgtagtgcattcacatagtaactgatttaatttaaagtacctaggc 38865576  T
201 acattataatactagttaatttgaaactttaaataaaagcaagataccatatcctaccatacatacgagtataacttccctatatataatcctcatctaa 300  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38865575 acattataatactagttaatttgaaactttaaataaaagcaagataccatatcctaccatacatacgagtataacttccctatatataatcctcatctaa 38865476  T
301 gataacataccaacaactcaatctctaattaaataactatcaactagttccccaacaaaaaacaatgtatgctgctcctacttcctttacttcacaactc 400  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||    
38865475 gataacataccaacaactcaatctctaattaaataactatcaactagttccccaacaaaaaacaatgtatgctgcttctacttcctttacttcacaactc 38865376  T
401 gtccatgagcttcttgtggaatctcacacaagaagggtactctttcaagacccaattg 458  Q
    |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
38865375 gtccatgagcttcttgtggaatctcacacaagaaggttactctttcaagacccaattg 38865318  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 75; E-Value: 3e-34
Query Start/End: Original strand, 213 - 454
Target Start/End: Complemental strand, 38841505 - 38841273
Alignment:
213 tagttaatttgaaactttaaataaaagcaagataccatatcctaccata-catacgagtataacttccctatatataatcctcatctaagataacatacc 311  Q
    ||||||| || ||||||| |||||| ||||||||||||||||||| ||| ||||      |||||||||||||||||||||||| |||||||||||||      
38841505 tagttaaattcaaacttttaataaa-gcaagataccatatcctacaatatcata------taacttccctatatataatcctcaactaagataacataaa 38841413  T
312 aacaactcaatctctaattaaataact-atcaactagttccccaacaaaaaacaatgtatgctgctcctacttcctttacttcacaactcgtccatgagc 410  Q
    |||||||||| ||||||| || ||||| ||||| || |||| ||| ||||||| |||||   |||| ||| |||||||||| ||||| |  || ||||||    
38841412 aacaactcaagctctaataaactaactcatcaattacttcctcaagaaaaaac-atgta---tgcttctatttcctttactacacaaatattcaatgagc 38841317  T
411 ttcttgtggaatctcacacaagaagggtactctttcaagaccca 454  Q
    |||||||||||||||||| ||||||| ||||| ||||| |||||    
38841316 ttcttgtggaatctcacataagaaggttactcattcaaaaccca 38841273  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 273 - 454
Target Start/End: Complemental strand, 38862068 - 38861891
Alignment:
273 aacttccctatatataatcctcatctaagata--acataccaacaactcaatctctaattaaataactatcaactagttccccaacaaaaaacaatgtat 370  Q
    ||||||||||||||||  ||| | ||||||||  ||||| || |||||||| |||||||||| |||||   ||  | |||||||||||||||||||||||    
38862068 aacttccctatatatacccctaa-ctaagatacaacataacagcaactcaagctctaattaactaactcataa--aattccccaacaaaaaacaatgtat 38861972  T
371 gctgctcctacttcctttacttcacaactcgtccatgagcttcttgtggaatctcacacaagaagggtactctttcaagaccca 454  Q
    ||| ||   |||||||||||||||| |||  ||||||| ||||||||||||||||||||||||||| ||||| ||||| |||||    
38861971 gcttct---acttcctttacttcaccacttctccatgaacttcttgtggaatctcacacaagaaggttactcattcaaaaccca 38861891  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 453 - 527
Target Start/End: Complemental strand, 38865867 - 38865794
Alignment:
453 caattggtgtcatttacattatcccgcccgcttttaattaggaaccncgtcttcttaaacaaaacatatatattg 527  Q
    |||||| ||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||    
38865867 caattgttgtcatttacattatcccgcccgcttt-aattaggaaccacgtcttcttaaacaaaacatatatattg 38865794  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 348 - 458
Target Start/End: Complemental strand, 38827591 - 38827484
Alignment:
348 ttccccaacaaaaaacaatgtatgctgctcctacttcctttacttcacaactcgtccatgagcttcttgtggaatctcacacaagaagggtactctttca 447  Q
    |||||||||| ||||||||||||||| ||   ||||| ||||||||||||||| |||||||||||||||| ||||| |||||||||||| ||||||| ||    
38827591 ttccccaacagaaaacaatgtatgcttct---acttcttttacttcacaactcctccatgagcttcttgtagaatcacacacaagaaggttactcttcca 38827495  T
448 agacccaattg 458  Q
    | | |||||||    
38827494 aaatccaattg 38827484  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 348 - 454
Target Start/End: Complemental strand, 38847169 - 38847066
Alignment:
348 ttccccaacaaaaaacaatgtatgctgctcctacttcctttacttcacaactcgtccatgagcttcttgtggaatctcacacaagaagggtactctttca 447  Q
    |||||||||| ||||||||||||||| ||   ||||| ||||||||||||||| |||||||||||||||| ||||| |||||||||||| ||||||| ||    
38847169 ttccccaacagaaaacaatgtatgcttct---acttcttttacttcacaactcctccatgagcttcttgtagaatcacacacaagaaggttactcttcca 38847073  T
448 agaccca 454  Q
    | |||||    
38847072 aaaccca 38847066  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 378 - 458
Target Start/End: Original strand, 38850579 - 38850659
Alignment:
378 ctacttcctttacttcacaactcgtccatgagcttcttgtggaatctcacacaagaagggtactctttcaagacccaattg 458  Q
    |||||||||| |||||||||||| |||||||||||||||| ||||| |||||||||||| ||||||| ||| | |||||||    
38850579 ctacttccttaacttcacaactcctccatgagcttcttgtagaatcacacacaagaaggttactcttccaaaatccaattg 38850659  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 373 - 454
Target Start/End: Complemental strand, 38859089 - 38859008
Alignment:
373 tgctcctacttcctttacttcacaactcgtccatgagcttcttgtggaatctcacacaagaagggtactctttcaagaccca 454  Q
    |||| ||||||| |||||||||| |||  | ||||||||||||||||||||||||||||||||| ||||| ||||| |||||    
38859089 tgcttctacttcttttacttcaccacttctacatgagcttcttgtggaatctcacacaagaaggttactcattcaaaaccca 38859008  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 203 - 256
Target Start/End: Original strand, 38850413 - 38850465
Alignment:
203 attataatactagttaatttgaaactttaaataaaagcaagataccatatccta 256  Q
    ||||||||| ||||||| || ||||||||| |||||||||||||||||||||||    
38850413 attataataatagttaaattcaaactttaa-taaaagcaagataccatatccta 38850465  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 14 - 63
Target Start/End: Complemental strand, 38862372 - 38862323
Alignment:
14 aaacaaatatttcatatggcaaaaagtattatttacggatccaattatat 63  Q
    ||||||||||||||||| |||||| | |||  ||||||||||||||||||    
38862372 aaacaaatatttcatatagcaaaagggatttgttacggatccaattatat 38862323  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 176082 times since January 2019
Visitors: 1578