View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5_3_82 (Length: 179)

Name: J5_3_82
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5_3_82
J5_3_82
[»] chr2 (2 HSPs)
chr2 (1-179)||(43005974-43006153)
chr2 (106-171)||(42997740-42997805)
[»] chr3 (1 HSPs)
chr3 (49-141)||(19314531-19314624)


Alignment Details
Target: chr2 (Bit Score: 151; Significance: 4e-80; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 151; E-Value: 4e-80
Query Start/End: Original strand, 1 - 179
Target Start/End: Original strand, 43005974 - 43006153
Alignment:
1 aaaaagcagccaagaacatcctgctagcaaagcacccaacttcaccacttgtatgtatttcttattattttcatctacttgcaa-cttgtttgaannnnn 99  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||         
43005974 aaaaagcagccaagaacatcctgctagcaaagcacccaacttcaccacttgtatgtatttcttattattttcatctacttgcaaccttgtttgaattttt 43006073  T
100 nngttatgattttcaattcctacctggattggcatctaaaaactatgacccatttagaagattgttgtgtatgcatttga 179  Q
      ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43006074 ttgttatgattttcaattcctacctggattggcatctaaaaactatgacccatttagaagattgttgtgtatgcatttga 43006153  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 106 - 171
Target Start/End: Original strand, 42997740 - 42997805
Alignment:
106 tgattttcaattcctacctggattggcatctaaaaactatgacccatttagaagattgttgtgtat 171  Q
    |||||||||||| || ||| |||||||||||| |||||||   |||||||||||||||||| ||||    
42997740 tgattttcaattactgccttgattggcatctacaaactattctccatttagaagattgttgcgtat 42997805  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 29; Significance: 0.0000002; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 49 - 141
Target Start/End: Original strand, 19314531 - 19314624
Alignment:
49 ttgtatgtatttcttattattttcatctacttgcaactt-gtttgaannnnnnngttatgattttcaattcctacctggattggcatctaaaaa 141  Q
    |||| ||||||||||||||||||||  | |||||||||| |||||||        |  ||||||| |||| |||||||||||||||||||||||    
19314531 ttgtgtgtatttcttattattttcagatgcttgcaactttgtttgaatttttttctcgtgatttttaattactacctggattggcatctaaaaa 19314624  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 201061 times since January 2019
Visitors: 1513