View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5_4_11 (Length: 191)

Name: J5_4_11
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5_4_11
J5_4_11
[»] chr5 (2 HSPs)
chr5 (1-116)||(28791736-28791851)
chr5 (111-191)||(28791847-28791927)


Alignment Details
Target: chr5 (Bit Score: 116; Significance: 3e-59; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 116; E-Value: 3e-59
Query Start/End: Original strand, 1 - 116
Target Start/End: Complemental strand, 28791851 - 28791736
Alignment:
1 aatttaaccttataatgtatgatgtaatggtttaatcattttacctaatgcaaaaaatgttctatgcctgttcttgaaaaccaatatcagagtaatggat 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28791851 aatttaaccttataatgtatgatgtaatggtttaatcattttacctaatgcaaaaaatgttctatgcctgttcttgaaaaccaatatcagagtaatggat 28791752  T
101 tggtactcttattaat 116  Q
    ||||||||||||||||    
28791751 tggtactcttattaat 28791736  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 81; E-Value: 2e-38
Query Start/End: Original strand, 111 - 191
Target Start/End: Complemental strand, 28791927 - 28791847
Alignment:
111 attaattttcatcacttcttccaaagcatcgaaccattgtaagtttcagtctcaaaactttcttcttgaacactggaattt 191  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28791927 attaattttcatcacttcttccaaagcatcgaaccattgtaagtttcagtctcaaaactttcttcttgaacactggaattt 28791847  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 314219 times since January 2019
Visitors: 446