View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5_4_19 (Length: 573)

Name: J5_4_19
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5_4_19
J5_4_19
[»] scaffold0381 (2 HSPs)
scaffold0381 (1-355)||(3806-4160)
scaffold0381 (350-483)||(4216-4348)
[»] chr4 (2 HSPs)
chr4 (1-355)||(27015623-27015977)
chr4 (350-483)||(27015435-27015567)
[»] chr1 (1 HSPs)
chr1 (169-286)||(20771638-20771753)
[»] chr3 (1 HSPs)
chr3 (354-477)||(12530535-12530661)
[»] chr2 (1 HSPs)
chr2 (69-128)||(11769476-11769535)


Alignment Details
Target: scaffold0381 (Bit Score: 351; Significance: 0; HSPs: 2)
Name: scaffold0381
Description:

Target: scaffold0381; HSP #1
Raw Score: 351; E-Value: 0
Query Start/End: Original strand, 1 - 355
Target Start/End: Complemental strand, 4160 - 3806
Alignment:
1 gaaaccctaggagagaaaacaatataatgttcaaatcgaaattgtcatcttctgtacctggaaatcgaacagtagaagtaaacaatgcaggtggaaacga 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4160 gaaaccctaggagagaaaacaatataatgttcaaatcgaaattgtcatcttctgtacctggaaatcgaacagtagaagtaaacaatgcaggtggaaacga 4061  T
101 aataggagagtgatcggagaagcaccgtaactctaaagctcactctgatcacaatacacttaaatcagagcttattatatcatttgttatgttgcagttt 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4060 aataggagagtgatcggagaagcaccgtaactctaaagctcactctgatcacaatacacttaaatcagagcttattatatcatttgttatgttgcagttt 3961  T
201 taatgatttgtatatatttgttttttctatgtagttttaaagtacaatggctaactcaggaactatttgatactatcaaacattatgtgtaatttggaca 300  Q
    |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3960 taatgatttgtatatatttgttttttctatgtagttttaaggtacaatggctaactcaggaactatttgatactatcaaacattatgtgtaatttggaca 3861  T
301 tccttatttgcatgattttgtgccaatttcagtatcataaaataaattcattaat 355  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3860 tccttatttgcatgattttgtgccaatttcagtatcataaaataaattcattaat 3806  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0381; HSP #2
Raw Score: 107; E-Value: 2e-53
Query Start/End: Original strand, 350 - 483
Target Start/End: Complemental strand, 4348 - 4216
Alignment:
350 attaatcaatcggtgatgtaatcataattcttgtgcagccaacaactacagggaaaaggtgggtttagatatagcaacctagccagccctgccacatgga 449  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||    
4348 attaatcaatcggtgatgtaatcataattcttgtgcagccaacaactacagggaaaaggtgagtttagatatagcaacctagccagccatgccacatgga 4249  T
450 gatatccctcctgnaatagagnacaaaaacgatc 483  Q
    ||||||| || || ||||||| ||||||||||||    
4248 gatatccatcatg-aatagagaacaaaaacgatc 4216  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 351; Significance: 0; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 351; E-Value: 0
Query Start/End: Original strand, 1 - 355
Target Start/End: Original strand, 27015623 - 27015977
Alignment:
1 gaaaccctaggagagaaaacaatataatgttcaaatcgaaattgtcatcttctgtacctggaaatcgaacagtagaagtaaacaatgcaggtggaaacga 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27015623 gaaaccctaggagagaaaacaatataatgttcaaatcgaaattgtcatcttctgtacctggaaatcgaacagtagaagtaaacaatgcaggtggaaacga 27015722  T
101 aataggagagtgatcggagaagcaccgtaactctaaagctcactctgatcacaatacacttaaatcagagcttattatatcatttgttatgttgcagttt 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27015723 aataggagagtgatcggagaagcaccgtaactctaaagctcactctgatcacaatacacttaaatcagagcttattatatcatttgttatgttgcagttt 27015822  T
201 taatgatttgtatatatttgttttttctatgtagttttaaagtacaatggctaactcaggaactatttgatactatcaaacattatgtgtaatttggaca 300  Q
    |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27015823 taatgatttgtatatatttgttttttctatgtagttttaaggtacaatggctaactcaggaactatttgatactatcaaacattatgtgtaatttggaca 27015922  T
301 tccttatttgcatgattttgtgccaatttcagtatcataaaataaattcattaat 355  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27015923 tccttatttgcatgattttgtgccaatttcagtatcataaaataaattcattaat 27015977  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 107; E-Value: 2e-53
Query Start/End: Original strand, 350 - 483
Target Start/End: Original strand, 27015435 - 27015567
Alignment:
350 attaatcaatcggtgatgtaatcataattcttgtgcagccaacaactacagggaaaaggtgggtttagatatagcaacctagccagccctgccacatgga 449  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||    
27015435 attaatcaatcggtgatgtaatcataattcttgtgcagccaacaactacagggaaaaggtgagtttagatatagcaacctagccagccatgccacatgga 27015534  T
450 gatatccctcctgnaatagagnacaaaaacgatc 483  Q
    ||||||| || || ||||||| ||||||||||||    
27015535 gatatccatcatg-aatagagaacaaaaacgatc 27015567  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 87; Significance: 2e-41; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 87; E-Value: 2e-41
Query Start/End: Original strand, 169 - 286
Target Start/End: Original strand, 20771638 - 20771753
Alignment:
169 agcttattatatcatttgttatgttgcagttttaatgatttgtatatatttgttttttctatgtagttttaaagtacaatggctaactcaggaactattt 268  Q
    ||||||||||||| ||||| ||||||||||||||||||||||||||  |||||||||||||||||||||||| ||| |||| ||||||||||||||||||    
20771638 agcttattatatcttttgtcatgttgcagttttaatgatttgtata--tttgttttttctatgtagttttaaggtagaatgactaactcaggaactattt 20771735  T
269 gatactatcaaacattat 286  Q
    ||||||||||||||||||    
20771736 gatactatcaaacattat 20771753  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 55; Significance: 2e-22; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 354 - 477
Target Start/End: Original strand, 12530535 - 12530661
Alignment:
354 atcaatcggtgatgtaatcataattctt-gtgcagccaacaactacagggaaaaggtgggtttagatatagc---aacctagccagccctgccacatgga 449  Q
    |||||||||||||||||||||||||||| ||| ||||||||| || |||||||||||| |||||||||||||   |||||  ||| || |||||||||||    
12530535 atcaatcggtgatgtaatcataattctttgtgtagccaacaattaaagggaaaaggtgagtttagatatagcaaaaacctgaccaaccatgccacatgga 12530634  T
450 gatatccctcctgnaatagagnacaaaa 477  Q
    ||||||| || || ||||||| ||||||    
12530635 gatatccatcatg-aatagagaacaaaa 12530661  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 36; Significance: 0.00000000005; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 69 - 128
Target Start/End: Complemental strand, 11769535 - 11769476
Alignment:
69 acagtagaagtaaacaatgcaggtggaaacgaaataggagagtgatcggagaagcaccgt 128  Q
    ||||||||||||||||||||||||| || || ||| ||| | ||||||||||||||||||    
11769535 acagtagaagtaaacaatgcaggtgaaaccggaatcggaaattgatcggagaagcaccgt 11769476  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 110894 times since January 2019
Visitors: 1335