View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5_4_2 (Length: 83)

Name: J5_4_2
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5_4_2
J5_4_2
[»] chr5 (2 HSPs)
chr5 (30-83)||(13476398-13476451)
chr5 (1-36)||(13476367-13476402)


Alignment Details
Target: chr5 (Bit Score: 54; Significance: 1e-22; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 54; E-Value: 1e-22
Query Start/End: Original strand, 30 - 83
Target Start/End: Complemental strand, 13476451 - 13476398
Alignment:
30 aattaataaacagcagattgagcaagaacagtacaagtcctttaaaagtcttgt 83  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13476451 aattaataaacagcagattgagcaagaacagtacaagtcctttaaaagtcttgt 13476398  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 36
Target Start/End: Complemental strand, 13476402 - 13476367
Alignment:
1 cttgttcagctgcaatgggaaggttgatcaattaat 36  Q
    ||||||||||||||||||||| ||||||||||||||    
13476402 cttgttcagctgcaatgggaaagttgatcaattaat 13476367  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 108227 times since January 2019
Visitors: 1329