View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5_4_22 (Length: 622)

Name: J5_4_22
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5_4_22
J5_4_22
[»] chr5 (5 HSPs)
chr5 (128-425)||(31258493-31258788)
chr5 (139-309)||(31257546-31257716)
chr5 (245-365)||(31259629-31259748)
chr5 (143-309)||(31258088-31258254)
chr5 (1-49)||(31258867-31258915)


Alignment Details
Target: chr5 (Bit Score: 267; Significance: 1e-149; HSPs: 5)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 128 - 425
Target Start/End: Complemental strand, 31258788 - 31258493
Alignment:
128 cttcttcgtgctgaccttttgggttttgttgtcccagccgacattgtacacttgtttcctttttcatataaattggcatatattgatttaaaaaccgtca 227  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31258788 cttcttcgtgctgaccttttgggttttgttgtcccagccgacattgtacacttgtttcctttttcatataaattggcatatattgatttaaaaaccgtca 31258689  T
228 agagttgacgtggtggtgtgtgtattggaacttaataaggagtatgcttatctcgaggttcgatgtttgaatttgataacaaattcntctgtttgatcga 327  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||    
31258688 agagttgacgtggtggtgtgtgtattggaacttaataaggagtatgcttatctcgaggttcgatgtttgaatttgataac-aattcatctgtttgatcga 31258590  T
328 tctatacatgtcttttctctcccttcaaataggtttcctttaanaatgtaatatttaaaaagaanggnatgagacctttttatnataatgtatttacc 425  Q
    ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| || |||||| |||||||| ||||||||||||||    
31258589 tctatacatgtcttttctctcccttcaaataggtttcctttaagaatgtaatatttaaaaagaagggtatgaga-ctttttataataatgtatttacc 31258493  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 83; E-Value: 5e-39
Query Start/End: Original strand, 139 - 309
Target Start/End: Complemental strand, 31257716 - 31257546
Alignment:
139 tgaccttttgggttttgttgtcccagccgacattgtacacttgtttcctttttcatataaattggcatatattgatttaaaaaccgtcaagagttgacgt 238  Q
    ||||||||||||||||| ||||||| || || || |||||| |||| || |||||||||||| |||||||||| |||||||| | |||| || ||||| |    
31257716 tgaccttttgggttttgctgtcccatccaactttatacactcgttttctctttcatataaataggcatatattaatttaaaacctgtcatgaattgacat 31257617  T
239 ggtggtgtgtgtattggaacttaataaggagtatgcttatctcgaggttcgatgtttgaatttgataacaa 309  Q
    ||| ||||||||||||||||||||| |||| | ||||||||||||||||| |||||| ||| |||||||||    
31257616 ggtagtgtgtgtattggaacttaatgaggattgtgcttatctcgaggttctatgtttaaatctgataacaa 31257546  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 245 - 365
Target Start/End: Complemental strand, 31259748 - 31259629
Alignment:
245 gtgtgtattggaacttaataaggagtatgcttatctcgaggttcgatgtttgaatttgataacaaattcntctgtttgatcgatctatacatgtcttttc 344  Q
    |||||||||| |||||||| |||||| ||||||||||||||||| ||||||||||||||| | ||| || | || | ||||| |||||||||| ||||||    
31259748 gtgtgtattgaaacttaatgaggagtgtgcttatctcgaggttccatgtttgaatttgatga-aaaatcatgtgatggatcggtctatacatggcttttc 31259650  T
345 tctcccttcaaataggtttcc 365  Q
    |||||||| ||||||||||||    
31259649 tctccctttaaataggtttcc 31259629  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 143 - 309
Target Start/End: Complemental strand, 31258254 - 31258088
Alignment:
143 cttttgggttttgttgtcccagccgacattgtacacttgtttcctttttcatataaattggcatatattgatttaaaaaccgtcaagagttgacgtggtg 242  Q
    |||||||||||||||| | || || || |||||||||  ||| || |||||||||||| |||||||||| ||| ||| ||||||||| ||||| || |      
31258254 cttttgggttttgttg-ctcacccaactttgtacactcattttctatttcatataaataggcatatattaattcaaacaccgtcaagtgttgaagtagca 31258156  T
243 gtgtgtgtattggaacttaataaggagtatgc-ttatctcgaggttcgatgtttgaatttgataacaa 309  Q
    ||||||||||||||||||||| |||||| ||| || |||||||| |  || ||||||| |||||||||    
31258155 gtgtgtgtattggaacttaatgaggagtgtgctttttctcgaggcttcatctttgaatctgataacaa 31258088  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 31258915 - 31258867
Alignment:
1 ggttcatggtccatttgagatgggtttttggttgaattgcatgtgctgc 49  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||    
31258915 ggttcatggtccatttgagatgggtttttggttgaattgcatgtgctgc 31258867  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 176086 times since January 2019
Visitors: 1578