View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5_4_31 (Length: 488)

Name: J5_4_31
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5_4_31
J5_4_31
[»] chr2 (4 HSPs)
chr2 (44-398)||(3374763-3375117)
chr2 (79-398)||(3349358-3349677)
chr2 (1-49)||(3349314-3349362)
chr2 (1-49)||(3374719-3374767)


Alignment Details
Target: chr2 (Bit Score: 304; Significance: 1e-171; HSPs: 4)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 304; E-Value: 1e-171
Query Start/End: Original strand, 44 - 398
Target Start/End: Complemental strand, 3375117 - 3374763
Alignment:
44 attaataccaactgagttaagctcannnnnnnnnnattaacatggttatgatttattgaatttgtaggacgttcatttatacatgcaaatgctgataagc 143  Q
    |||||||||||||||||||||||||          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3375117 attaataccaactgagttaagctcattttttttttattaacatggttatgatttattgaatttgtaggacgttcatttatacatgcaaatgctgataagc 3375018  T
144 tgctgaatgaagtgaaagacgattgccctcgttggttagctattgttcttcctgctatgattgaacttgctgatgaaatcatgggtttagatgtgctctt 243  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3375017 tgctgaatgaagtgaaagacgattgccctcgttggttagctattgttcttcctgctatgattgaacttgctgatgaaatcatgggtttagatgtgctctt 3374918  T
244 cacaaagtcatcaagggacaccatgtcctacattgctaaccgtcggaaaagttttcttaacaagtatatatacttatactttattttannnnnnngaggg 343  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       |||||    
3374917 cacaaagtcatcaagggacaccatgtcctacattgctaaccgtcggaaaagttttcttaacaagtatatatacttatactttattttatttttttgaggg 3374818  T
344 aaagtatacttacatttatttaatgcattacataaaacaatttcattgcatgtgt 398  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3374817 aaagtatacttacatttatttaatgcattacataaaacaatttcattgcatgtgt 3374763  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 299; E-Value: 1e-168
Query Start/End: Original strand, 79 - 398
Target Start/End: Complemental strand, 3349677 - 3349358
Alignment:
79 attaacatggttatgatttattgaatttgtaggacgttcatttatacatgcaaatgctgataagctgctgaatgaagtgaaagacgattgccctcgttgg 178  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3349677 attaacatggttatgatttattgaatttgtaggacgttcatttatacatgcaaatgctgataagctgctgaatgaagtgaaagacgattgccctcgttgg 3349578  T
179 ttagctattgttcttcctgctatgattgaacttgctgatgaaatcatgggtttagatgtgctcttcacaaagtcatcaagggacaccatgtcctacattg 278  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3349577 ttagctattgttcttcctgctatgattgaacttgctgatgaaatcatgggtttagatgtgctcttcacaaagtcatcaagggacaccatgtcctacattg 3349478  T
279 ctaaccgtcggaaaagttttcttaacaagtatatatacttatactttattttannnnnnngagggaaagtatacttacatttatttaatgcattacataa 378  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||       ||||||||||||||||||||||||||||||||||||||||    
3349477 ctaaccgtcggaaaagttttcttaacaagtatatatacttatactttattttatttttttgagggaaagtatacttacatttatttaatgcattacataa 3349378  T
379 aacaatttcattgcatgtgt 398  Q
    ||||||||||||||||||||    
3349377 aacaatttcattgcatgtgt 3349358  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 3349362 - 3349314
Alignment:
1 tgtgtagggaggaagttgttggggattttgattggtaccctccattaat 49  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||    
3349362 tgtgtagggaggaagttgttggggattttgattggtaccctccattaat 3349314  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 3374767 - 3374719
Alignment:
1 tgtgtagggaggaagttgttggggattttgattggtaccctccattaat 49  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||    
3374767 tgtgtagggaggaagttgttggggattttgattggtaccctccattaat 3374719  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 203493 times since January 2019
Visitors: 1517