View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5_4_41 (Length: 312)

Name: J5_4_41
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5_4_41
J5_4_41
[»] chr4 (4 HSPs)
chr4 (1-199)||(34515995-34516193)
chr4 (2-192)||(34505869-34506062)
chr4 (188-312)||(34516189-34516313)
chr4 (236-312)||(34506059-34506135)
[»] chr2 (1 HSPs)
chr2 (2-81)||(4690051-4690130)


Alignment Details
Target: chr4 (Bit Score: 199; Significance: 1e-108; HSPs: 4)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 199
Target Start/End: Complemental strand, 34516193 - 34515995
Alignment:
1 tgcatgaatcatacaagacaatgattcccacatgtttagactcaatgaatcacccacaaacattatctttttacccttccacctattcaagaaatcctct 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34516193 tgcatgaatcatacaagacaatgattcccacatgtttagactcaatgaatcacccacaaacattatctttttacccttccacctattcaagaaatcctct 34516094  T
101 ccattgaacctacaccacaaaaataatttactcattacatttgcactatacattaggagaagaaatttagtacactaattacattacaaaatattaatc 199  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34516093 ccattgaacctacaccacaaaaataatttactcattacatttgcactatacattaggagaagaaatttagtacactaattacattacaaaatattaatc 34515995  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 137; E-Value: 2e-71
Query Start/End: Original strand, 2 - 192
Target Start/End: Complemental strand, 34506062 - 34505869
Alignment:
2 gcatgaatcatacaagacaatgattcccacatgtttagactcaatgaatcacccacaaacattatctttttacccttccacctattcaagaaatcctctc 101  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||    
34506062 gcatgaatcatacaagacaatgattcccacatgtttagactcaatgaatcacccacaaacattatcttcttatccttccacctattcaagaaatcctctc 34505963  T
102 cattgaac---ctacaccacaaaaataatttactcattacatttgcact-atacattaggagaagaaatttagtacactaattacattacaaaat 192  Q
    ||||||||   ||||||||||||||||| |||||||||||||||| ||| |||||||| ||||||| ||| ||||||||||||| ||||||||||    
34505962 cattgaacctgctacaccacaaaaataa-ttactcattacatttgtactaatacattatgagaagatattaagtacactaattatattacaaaat 34505869  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 121; E-Value: 5e-62
Query Start/End: Original strand, 188 - 312
Target Start/End: Complemental strand, 34516313 - 34516189
Alignment:
188 aaaatattaatcattgcatttgaaacaagagagaaagacaacaagaacaactattacctggaaaatcacagtagacactgattctttcctagaaaagctt 287  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34516313 aaaaaattaatcattgcatttgaaacaagagagaaagacaacaagaacaactattacctggaaaatcacagtagacactgattctttcctagaaaagctt 34516214  T
288 gtagtggcatttggtaccgatgcat 312  Q
    |||||||||||||||||||||||||    
34516213 gtagtggcatttggtaccgatgcat 34516189  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 236 - 312
Target Start/End: Complemental strand, 34506135 - 34506059
Alignment:
236 aactattacctggaaaatcacagtagacactgattctttcctagaaaagcttgtagtggcatttggtaccgatgcat 312  Q
    |||||||||| |||| |  |||||||||| || ||||||||||||||||||||||||| |||| || ||||| ||||    
34506135 aactattacccggaagaagacagtagacattggttctttcctagaaaagcttgtagtgacattcggaaccgacgcat 34506059  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 56; Significance: 3e-23; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 2 - 81
Target Start/End: Original strand, 4690051 - 4690130
Alignment:
2 gcatgaatcatacaagacaatgattcccacatgtttagactcaatgaatcacccacaaacattatctttttacccttcca 81  Q
    |||||||||||||| |||| ||||||||||||||| ||||||| |||||||||||||||||||||||| |||||| ||||    
4690051 gcatgaatcatacacgacagtgattcccacatgttcagactcagtgaatcacccacaaacattatcttcttacccctcca 4690130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 361214 times since January 2019
Visitors: 487