View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5_4_49 (Length: 257)

Name: J5_4_49
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5_4_49
J5_4_49
[»] chr4 (1 HSPs)
chr4 (1-257)||(18015260-18015516)
[»] chr2 (1 HSPs)
chr2 (1-257)||(3063804-3064060)


Alignment Details
Target: chr4 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 1 - 257
Target Start/End: Complemental strand, 18015516 - 18015260
Alignment:
1 aggtgtgtgatgaaaattgtcagggctagctcttgtagtgtatttttattgggattttattacataaaaacttccatatgagaaaagggttagtattatt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
18015516 aggtgtgtgatgaaaattgtcagggctagctcttgtagtgtatttttattgggattttattacataaaaacttccatatgagaaaagggttagtattatt 18015417  T
101 aattatgtaagaaagacaaatgccaattttcctcacttgtaacgtaatcctcacgcagggcacattgacattgactttgacttttagtgttgattgatta 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
18015416 aattatgtaagaaagacaaatgccaattttcctcacttgtaacgtaatcctcacgcagggcacattgacattgactttgacttttagtgttgattgatta 18015317  T
201 agaaattgttgnnnnnnncttgttcattgatatggtctattgagtcaaatgatcttg 257  Q
    |||||||||||       |||||||||||||||||||||||||||||||||||||||    
18015316 agaaattgttgtttttttcttgttcattgatatggtctattgagtcaaatgatcttg 18015260  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 1 - 257
Target Start/End: Original strand, 3063804 - 3064060
Alignment:
1 aggtgtgtgatgaaaattgtcagggctagctcttgtagtgtatttttattgggattttattacataaaaacttccatatgagaaaagggttagtattatt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3063804 aggtgtgtgatgaaaattgtcagggctagctcttgtagtgtatttttattgggattttattacataaaaacttccatatgagaaaagggttagtattatt 3063903  T
101 aattatgtaagaaagacaaatgccaattttcctcacttgtaacgtaatcctcacgcagggcacattgacattgactttgacttttagtgttgattgatta 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3063904 aattatgtaagaaagacaaatgccaattttcctcacttgtaacgtaatcctcacgcagggcacattgacattgactttgacttttagtgttgattgatta 3064003  T
201 agaaattgttgnnnnnnncttgttcattgatatggtctattgagtcaaatgatcttg 257  Q
    |||||||||||       |||||||||||||||||||||||||||||||||||||||    
3064004 agaaattgttgtttttttcttgttcattgatatggtctattgagtcaaatgatcttg 3064060  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 360620 times since January 2019
Visitors: 484