View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5_4_53 (Length: 113)

Name: J5_4_53
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5_4_53
J5_4_53
[»] chr4 (1 HSPs)
chr4 (1-113)||(29103734-29103846)
[»] chr8 (2 HSPs)
chr8 (14-75)||(24538526-24538587)
chr8 (13-69)||(14695921-14695977)


Alignment Details
Target: chr4 (Bit Score: 113; Significance: 1e-57; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 113; E-Value: 1e-57
Query Start/End: Original strand, 1 - 113
Target Start/End: Original strand, 29103734 - 29103846
Alignment:
1 ttttctccctctttttcaaatttcaatgttatcctctctttatattttaatggtctagattgtcacattatttcctcttgagaggatcttaatctcacac 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29103734 ttttctccctctttttcaaatttcaatgttatcctctctttatattttaatggtctagattgtcacattatttcctcttgagaggatcttaatctcacac 29103833  T
101 ttgagggtgagaa 113  Q
    |||||||||||||    
29103834 ttgagggtgagaa 29103846  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 34; Significance: 0.0000000001; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000001
Query Start/End: Original strand, 14 - 75
Target Start/End: Original strand, 24538526 - 24538587
Alignment:
14 tttcaaatttcaatgttatcctctctttatattttaatggtctagattgtcacattatttcc 75  Q
    ||||||||||||| | ||||||| |||||||||| |||| |||| ||| |||||||||||||    
24538526 tttcaaatttcaaagatatcctccctttatatttcaatgctctaaattttcacattatttcc 24538587  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000001
Query Start/End: Original strand, 13 - 69
Target Start/End: Original strand, 14695921 - 14695977
Alignment:
13 ttttcaaatttcaatgttatcctctctttatattttaatggtctagattgtcacatt 69  Q
    |||| |||||| ||||||||||||  ||||||||| |||||| |||||| |||||||    
14695921 ttttaaaattttaatgttatcctccatttatatttcaatggtgtagattttcacatt 14695977  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 108463 times since January 2019
Visitors: 1329