View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5_4_55 (Length: 236)

Name: J5_4_55
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5_4_55
J5_4_55
[»] chr4 (1 HSPs)
chr4 (1-236)||(23290472-23290708)


Alignment Details
Target: chr4 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 236
Target Start/End: Original strand, 23290472 - 23290708
Alignment:
1 acaaattctgcgcttataaggtaccattctctgattcttccttataccgtttt-tcattctccgctcagttttgtttctatttaccattgttataatcga 99  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
23290472 acaaattctgcgcttataaggtaccattctctgattcttccttataccgttttttcattctccgctcagttttgtttctatttaccattgttataatcga 23290571  T
100 tcatgcatgaagcgattctagttactatacttcttttttcatctcatcatcaccattgattcagaaacccacacctataacttcattgatattcgagttt 199  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
23290572 tcatgcatgaagcgattctagttactatacttcttttttcatctcatcatcaccattgattcagaaacccacacctataacttcattgatattcgagttt 23290671  T
200 tcttttgactctgaattggttgaagtgaatttagagc 236  Q
    |||||||||||||||||||||||||||||||||||||    
23290672 tcttttgactctgaattggttgaagtgaatttagagc 23290708  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 308919 times since January 2019
Visitors: 444