View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5_4_57 (Length: 93)

Name: J5_4_57
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5_4_57
J5_4_57
[»] chr8 (1 HSPs)
chr8 (1-93)||(40012772-40012864)
[»] chr3 (2 HSPs)
chr3 (1-91)||(52023482-52023572)
chr3 (1-93)||(38683132-38683221)
[»] chr6 (1 HSPs)
chr6 (8-93)||(7857615-7857701)


Alignment Details
Target: chr8 (Bit Score: 93; Significance: 7e-46; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 93; E-Value: 7e-46
Query Start/End: Original strand, 1 - 93
Target Start/End: Original strand, 40012772 - 40012864
Alignment:
1 ctactgttcataaattttttagtttctatctcttattccagttggcattcttcaatggattacaataatccttgttgtcgttgcctcagctag 93  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40012772 ctactgttcataaattttttagtttctatctcttattccagttggcattcttcaatggattacaataatccttgttgtcgttgcctcagctag 40012864  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 71; Significance: 9e-33; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 71; E-Value: 9e-33
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 52023482 - 52023572
Alignment:
1 ctactgttcataaattttttagtttctatctcttattccagttggcattcttcaatggattacaataatccttgttgtcgttgcctcagct 91  Q
    |||||||||||| | |||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
52023482 ctactgttcatacaattttcagtttctatttcttattccagttggcattcttcaatggattacaataatccttgttgttgttgcctcagct 52023572  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 1 - 93
Target Start/End: Complemental strand, 38683221 - 38683132
Alignment:
1 ctactgttcataaattttttagtttctatctcttattccagttggcattcttcaatggattacaataatccttgttgtcgttgcctcagctag 93  Q
    |||||||||||||| |||| ||||||||| |||||||||||| ||||||||||||| |||||||||||||||||||   ||||||||||||||    
38683221 ctactgttcataaaattttcagtttctatttcttattccagtcggcattcttcaattgattacaataatccttgtt---gttgcctcagctag 38683132  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 35; Significance: 0.00000000003; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 35; E-Value: 0.00000000003
Query Start/End: Original strand, 8 - 93
Target Start/End: Original strand, 7857615 - 7857701
Alignment:
8 tcataaattttttagtttcta-tctcttattccagttggcattcttcaatggattacaataatccttgttgtcgttgcctcagctag 93  Q
    ||||||| |||| |||||||| | | |||||| ||||||  ||||||||| |||||||||||||||||  || ||||||||||||||    
7857615 tcataaaattttcagtttctaattttttattctagttggtgttcttcaatcgattacaataatccttgcggttgttgcctcagctag 7857701  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 361731 times since January 2019
Visitors: 488