View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5_4_58 (Length: 181)

Name: J5_4_58
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5_4_58
J5_4_58
[»] chr4 (5 HSPs)
chr4 (1-181)||(40310621-40310801)
chr4 (1-181)||(40320697-40320877)
chr4 (1-178)||(40313600-40313777)
chr4 (1-178)||(40323676-40323853)
chr4 (1-181)||(40330163-40330350)


Alignment Details
Target: chr4 (Bit Score: 181; Significance: 5e-98; HSPs: 5)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 181; E-Value: 5e-98
Query Start/End: Original strand, 1 - 181
Target Start/End: Complemental strand, 40310801 - 40310621
Alignment:
1 attttacccctttaaaaacaatggtgtcttttttatgttgttattgtggattgtcgtatcatctgtttggggaagaccagcaacttttaatcaagatttt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40310801 attttacccctttaaaaacaatggtgtcttttttatgttgttattgtggattgtcgtatcatctgtttggggaagaccagcaacttttaatcaagatttt 40310702  T
101 catgtcacgtggtcagaaccccatatcaagcaaattgatcaaggcagaactatccaacttaccctagaccaaggctctggt 181  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40310701 catgtcacgtggtcagaaccccatatcaagcaaattgatcaaggcagaactatccaacttaccctagaccaaggctctggt 40310621  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 181; E-Value: 5e-98
Query Start/End: Original strand, 1 - 181
Target Start/End: Complemental strand, 40320877 - 40320697
Alignment:
1 attttacccctttaaaaacaatggtgtcttttttatgttgttattgtggattgtcgtatcatctgtttggggaagaccagcaacttttaatcaagatttt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40320877 attttacccctttaaaaacaatggtgtcttttttatgttgttattgtggattgtcgtatcatctgtttggggaagaccagcaacttttaatcaagatttt 40320778  T
101 catgtcacgtggtcagaaccccatatcaagcaaattgatcaaggcagaactatccaacttaccctagaccaaggctctggt 181  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40320777 catgtcacgtggtcagaaccccatatcaagcaaattgatcaaggcagaactatccaacttaccctagaccaaggctctggt 40320697  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 166; E-Value: 4e-89
Query Start/End: Original strand, 1 - 178
Target Start/End: Complemental strand, 40313777 - 40313600
Alignment:
1 attttacccctttaaaaacaatggtgtcttttttatgttgttattgtggattgtcgtatcatctgtttggggaagaccagcaacttttaatcaagatttt 100  Q
    ||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||    
40313777 attttacccttttaaaaacaatggtatcttttttatgttgttattgtggattgtcgtatcatctgtttggggaagaccagcaacttttaatcaagacttt 40313678  T
101 catgtcacgtggtcagaaccccatatcaagcaaattgatcaaggcagaactatccaacttaccctagaccaaggctct 178  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40313677 catgtcacgtggtcagaaccccatatcaagcaaattgatcaaggcagaactatccaacttaccctagaccaaggctct 40313600  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 166; E-Value: 4e-89
Query Start/End: Original strand, 1 - 178
Target Start/End: Complemental strand, 40323853 - 40323676
Alignment:
1 attttacccctttaaaaacaatggtgtcttttttatgttgttattgtggattgtcgtatcatctgtttggggaagaccagcaacttttaatcaagatttt 100  Q
    ||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||    
40323853 attttacccttttaaaaacaatggtatcttttttatgttgttattgtggattgtcgtatcatctgtttggggaagaccagcaacttttaatcaagacttt 40323754  T
101 catgtcacgtggtcagaaccccatatcaagcaaattgatcaaggcagaactatccaacttaccctagaccaaggctct 178  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40323753 catgtcacgtggtcagaaccccatatcaagcaaattgatcaaggcagaactatccaacttaccctagaccaaggctct 40323676  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 122; E-Value: 8e-63
Query Start/End: Original strand, 1 - 181
Target Start/End: Complemental strand, 40330350 - 40330163
Alignment:
1 attttacccctttaaaaacaatggtgtcttttttatgttgttattgtggattgtcgtatcatctgttt-------ggggaagaccagcaacttttaatca 93  Q
    ||||| ||| |||||| ||||| ||||||||||||| |||||  |||||||| || |||||| |||||       |||||||||||||||||||||||||    
40330350 attttccccttttaaacacaatagtgtcttttttatattgttgatgtggattctcttatcatgtgtttttggtttggggaagaccagcaacttttaatca 40330251  T
94 agattttcatgtcacgtggtcagaaccccatatcaagcaaattgatcaaggcagaactatccaacttaccctagaccaaggctctggt 181  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40330250 agattttcatgtcacgtggtcagaaccccatatcaagcaaattgatcaaggcagaactatccaacttaccctagaccaaggctctggt 40330163  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 175602 times since January 2019
Visitors: 1577