View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: J5_4_59 (Length: 467)

Name: J5_4_59
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] J5_4_59
J5_4_59
[»] chr2 (1 HSPs)
chr2 (1-294)||(12315901-12316192)
[»] chr4 (1 HSPs)
chr4 (18-294)||(38834764-38835038)
[»] chr7 (1 HSPs)
chr7 (175-239)||(45101260-45101324)


Alignment Details
Target: chr2 (Bit Score: 275; Significance: 1e-153; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 275; E-Value: 1e-153
Query Start/End: Original strand, 1 - 294
Target Start/End: Complemental strand, 12316192 - 12315901
Alignment:
1 acaggatcagtaacaggtttaacatttgacaacatccaaatggagaatgtaagaaactgtatcaacatagaccaattctactgtttatcaaaagagtgta 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
12316192 acaggatcagtaacaggtttaacatttgacaacatccaaatggagaatgtaagaaactgtatcaacatagaccaattctactgtttatcaaaagagtgta 12316093  T
101 tgaaccaaacatcagcagtatatgtaaacaatatctcctacagaaaaataaagggtacatatgatgtgagaacacctcctatacattttgcttgtagtga 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
12316092 tgaaccaaacatcagcagtatatgtaaacaatatctcctacagaaaaataaagggtacatatgatgtgagaacacctcctatacattttgcttgtagtga 12315993  T
201 cactgntgcttgcacaaacataacactctctgagattgaacttttgccttatgaaggtgaattagtntgatgacccctttttgttggaatgctt 294  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||    
12315992 cactgttgcttgcacaaacataacactctctgagattgaacttttgccttatgaaggtgaattagt-tgatga-ccctttttgttggaatgctt 12315901  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 99; Significance: 1e-48; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 18 - 294
Target Start/End: Original strand, 38834764 - 38835038
Alignment:
18 tttaacatttgacaacatccaaatggagaatgtaagaaactgtatcaacatagaccaattctactgtttatcaaaagagtgtatgaaccaaacatcagca 117  Q
    ||||| |||||| ||||| ||||||||||||||| ||||||| |||   |||||||||| ||| |||||  |||| || ||| | || ||||| |||||     
38834764 tttaaaatttgagaacatacaaatggagaatgtaggaaactgcatccttatagaccaatactattgtttgacaaaggaatgtctaaatcaaacttcagct 38834863  T
118 gtatatgtaaacaatatctcctacagaaaaataaagggtacatatgatgtgagaacacctcctatacattttgcttgtagtgacactgntgcttgcacaa 217  Q
    ||| |||| ||  || | ||||||| ||| || |||||||| |||||||| |||||  ||||||| |||||||||||||||||||||| |||||| ||||    
38834864 gtacatgttaatgatgtgtcctacaaaaacattaagggtacttatgatgttagaactgctcctattcattttgcttgtagtgacactgttgcttgtacaa 38834963  T
218 acataacactctctgagattgaacttttgccttatgaaggtgaattagtntgatgacccctttttgttggaatgctt 294  Q
    ||||||||||||||||| |||| |||||||| | |||||||||||| ||  ||||| ||||||||||||||||||||    
38834964 acataacactctctgaggttgagcttttgccatttgaaggtgaatt-gttggatga-ccctttttgttggaatgctt 38835038  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 34; Significance: 0.0000000007; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 175 - 239
Target Start/End: Complemental strand, 45101324 - 45101260
Alignment:
175 cctcctatacattttgcttgtagtgacactgntgcttgcacaaacataacactctctgagattga 239  Q
    |||||||| |||||||||||||||||| |||   ||||||| |||||||||||||| || |||||    
45101324 cctcctatgcattttgcttgtagtgactctgtcccttgcactaacataacactctcagaaattga 45101260  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 201896 times since January 2019
Visitors: 1513